This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bowtie paired-end alignment failure

Hello I am trying to use bowtie2 to map paired end reads that we suspect to have orignated from circular RNAs.

We are using a custom reference genome that contains only the exons from dm3.

Using BLAT on a specific read I observe that both mates map to two ends of a specific exon (this makes sense as we suspect the read to originate from a circular RNA).

However when running bowtie2 we get the following output:

1 reads; of these:
  1 (100.00%) were paired; of these:
    1 (100.00%) aligned concordantly 0 times
    0 (0.00%) aligned concordantly exactly 1 time
    0 (0.00%) aligned concordantly >1 times
    ----
    1 pairs aligned concordantly 0 times; of these:
      0 (0.00%) aligned discordantly 1 time
    ----
    1 pairs aligned 0 times concordantly or discordantly; of these:
      2 mates make up the pairs; of these:
        0 (0.00%) aligned 0 times
        0 (0.00%) aligned exactly 1 time
        2 (100.00%) aligned >1 times
1100.00% overall alignment rate

1    113    chrX|"NM_001258798";|970    2005    1    20M    chrX|"NM_206775";|971    2976    0    GGTTGCGCTCGTTGGAACCG    IIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:20    YT:Z:UP

1    369    chrX|"NM_001201739";|969    4260    1    20M    chrX|"NM_206775";|971    2976    0    GGTTGCGCTCGTTGGAACCG    IIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:20    YT:Z:UP

**1    369    chrX|"NM_167594";|968    9655    1    20M    chrX|"NM_206775";|971    2976    0    GGTTGCGCTCGTTGGAACCG    IIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:20    YT:Z:UP**

1    369    chrX|"NM_001272735";|972    1052    1    20M    chrX|"NM_206775";|971    2976    0    GGTTGCGCTCGTTGGAACCG    IIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:20    YT:Z:UP

1    369    chrX|"NM_206775";|971    2002    1    20M    =    2976    0    GGTTGCGCTCGTTGGAACCG    IIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:20    YT:Z:UP

1    177    chrX|"NM_206775";|971    2976    1    45M    chrX|"NM_001258798";|970    2005    0    GTTGTTGCTGATATATAGTGCATAGGGCAGGAAGGCGATTAAACG    iIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:45    YT:Z:UP

1    433    chrX|"NM_001201739";|969    5478    1    45M    chrX|"NM_001258798";|970    2005    0    GTTGTTGCTGATATATAGTGCATAGGGCAGGAAGGCGATTAAACG    iIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:45    YT:Z:UP

1    433    chrX|"NM_001258798";|970    2979    1    45M    =    2005    0    GTTGTTGCTGATATATAGTGCATAGGGCAGGAAGGCGATTAAACG    iIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:45    YT:Z:UP

1    433    chrX|"NM_001272735";|972    2270    1    45M    chrX|"NM_001258798";|970    2005    0    GTTGTTGCTGATATATAGTGCATAGGGCAGGAAGGCGATTAAACG    iIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:45    YT:Z:UP

**1    433    chrX|"NM_167594";|968    10873    1    45M    chrX|"NM_001258798";|970    2005    0    GTTGTTGCTGATATATAGTGCATAGGGCAGGAAGGCGATTAAACG    iIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    AS:i:0    XS:i:0    XN:i:0    XM:i:0    XO:i:0    XG:i:0    NM:i:0    MD:Z:45    YT:Z:UP**

We tried modifiyng the allowed insert size using the -X parameter but this still did not yield a pair alignment.

From this thread I understand that it is possible that paired reads might not map as a pair even though both mates map if bowtie maps the two mates to different loci, but in this case both mates map to the same loci (shown in bold, which is also the gene found by BLAT) . I suspect that bowtie does not report this as an alignment of the pair because this is not the primary alignment of neither of the mates.

Is it possible to have bowtie report this as a pair alignment

thanks in advace

alignment rna-seq

From what I see, it looks like you are trying to map only one read, but you should also map its mate... what command did you use ? For paired-end data, it should looks like :

bowtie2 -x *index* -1 *read* -2 *mate*

1 answer

Try adding the --ff option, since the relative orientations of the alignments to each other is the main problem.

I tried to switch the fats files' names in order to oppose the order it has no effect

The order isn't the issue, the orientation issue will exist regardless.

I tried bowtie2 --ff -a -x newGenome -1 1.fastq -2 2.fastq

Or even manually reverse complete the sequence in each fatq file but it has no effect..:/

Log in to answer this question.