Write a Python script that translates two genes in an RNA sequence into their protein sequence and prints them. Each gene begins with an AUG from the left and ends in UAG and has a length that is a multiple of three. However, the RNA sequence length may not be a multiple of three and there may be more than one "UAG" or "AUG" in the sequence.
For example if the input is
human ACAUGCUAGAAUAGCCGCAUGUACUAGUUAA
with open ("p:/dna.txt", "r") as myfile:
data=myfile.readlines()
map = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L",
"UCU":"S", "UCC":"s", "UCA":"S", "UCG":"S",
"UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP",
"UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W",
"CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L",
"CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P",
"CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q",
"CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R",
"AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M",
"ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T",
"AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K",
"AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R",
"GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V",
"GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A",
"GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E",
"GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",}
DNA=data[1]
flag = 1
while flag:
start = DNA.find('AUG')
if start == -1:
flag = 0
else:
done = 0
while done!= 0:
i = start
codon = DNA[1:i+3]
if codon == "UAG":
stop = i
protein = translate(DNA(start))
DNA = DNA[stop:]
done = 1
print(protein)
then the output should be
MLE MY
I have this so far... http://dpaste.org/v2e9/ can anyone help out?
•
written
by
Studentguy •
homework? well, i'll answer anyway using biopython.
from Bio.Seq import Seq
from Bio.Alphabet import generic_rna
# add your own logic here to parse the rna sequence from the file.
# split on start codon. drop the part preceding the 1st start codon,
# then for each chunk, translate to the stop codon. then join and print.
print " ".join((str(Seq("AUG" + rest, generic_rna).translate(to_stop=True))
for rest in "ACAUGCUAGAAUAGCCGCAUGUACUAGUUAA".split("AUG")[1:]))
I'm not a python guy but the following script does the job with dna.txt=
>Human
ACAUGCUAGAAUAGCCGCAUGUACUAGUUAA
src: you just need to check if there is at least 3 bases available after the current position:
with open ("dna.txt", "r") as myfile:
data=myfile.readlines()
map = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L",
"UCU":"S", "UCC":"s", "UCA":"S", "UCG":"S",
"UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP",
"UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W",
"CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L",
"CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P",
"CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q",
"CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R",
"AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M",
"ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T",
"AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K",
"AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R",
"GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V",
"GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A",
"GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E",
"GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G",}
DNA=data[1].strip()
start = DNA.find('AUG')
if start!= -1:
while start+2 < len(DNA):
codon = DNA[start:start+3]
if codon == "UAG": break;
print(map[codon])
start+=3
•
written
by
Pierre Lindenbaum
hi i ran your code but there seem to be a problem with your code. When i read a data file n characters are also read. And the start variable seem to always get the value -1 even when the sub-string is present in DNA.
when I run your code I get this error:
start, end = next_transcript(mRNA, cur_pos)
TypeError: 'NoneType' object is not iterable
I also noticed that cur_pos isn't defined until later line 43. Could this be the problem? I am also not sure why in DNA=data[1].strip() you call for the second item 1 in the string? How is your dna.txt formated? This clarification would be much appreciated. Thanks
Thank you all for the fast responses, and to those who help i greatly appreciate it, i ended up with an alternate solution.
I am not really looking for handouts but I am new to programming and am occasionally very confused with python. Most uni's now require all bio majors to be thrown into the pit with a BNFO class since even with limited knowledge in the subject it is a valuable skill to have. that being said all of our teachers here are pretty seasoned vets in several languages and sometimes its hard to connect to "my first programming class"
heres the code i ended up using, it did away with that loop structure i couldnt get and kinda cheats by using find/rfind two narrow down two sequences, it wont work for more than two sequences but it does the job none the less
Nice work with this. Your logic is sound and the major remaining issue to tackle is repetitiveness in the code. Whenever you repeat code with a few changes, you should focus on making that code into a function. Here's a next version of your code generalized with functions and a while loop. It's a combination of your first and second attempts. Notice how the functions allow you to avoid re-writing the same code multiple times: http://gist.github.com/626765
from Bio import SeqIO , Seq
from Bio.SeqRecord import SeqRecord
def make_trans_record(record):
"Returns a new seqrecord with translated sequences"
return SeqRecord(seq = record.seq[350:-103].translate(),\
id = record.id,\
description = "")
Input = raw_input("Enter File location of the nucleotide sequence :")
Output = raw_input("Output file location and name :")
records = map(make_trans_record,SeqIO.parse(Input,"fasta"))
SeqIO.write(records,Output,"fasta")
Log in to answer this question.
I'd be interested in other moderators opinion of homework questions? I think proof of a reasonable stab at a solution would be a good thing, rather than 'do my homework for me' style questions.
I do agree, however there is for that question a partial solution if you follow the link to the OP's 'dpaste' page. Here is a thought. With enough googling, the StudentGuy will come up with an already made up solution anyways, most probably using Biopython, which he will likely not understand and which will be too much high order (using ready made package) to have much teaching value. At least here the OP did a part of the work and is ready to interact with people who likely will teach him something. A better developped question and including the code right here might have been better. Cheers
just need to find an otherwise permissive license that prohibits copy-paste use into a homework solution
@brentp: The people who are copy-pasting homework probably aren't reading enough to look at the licenses anyways.
@Simon: while I sometimes feel irked when I see a question that seems to be taken right out of a homework I think in the end is not our job to police this. Plus we may be wrong in our assumptions. So I would leave this up to everyone's individual opinion on whether they would want to answer it or not. A great solution to an answer lives on and will continue to provide value beyond the original poster's needs.
some consolation: I appreciates the frankness to write it as HW!!
I am not really looking for handouts but I am new to programming and am occasionally very confused with python. Most uni's now require all bio majors to be thrown into the pit with a BNFO class since even with limited knowledge in the subject it is a valuable skill to have. that being said all of our teachers here are pretty seasoned vets in several languages and sometimes its hard to connect to "my first programming class"
i posted more below in the answers section :D