This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Ribo-seq rRNA and other contaminants Fasta file for S. pombe

Hi everyone, I'm new to Ribo-seq and is working on S. Pombe, our lab has a fasta file for all the contaminants (rRNA, tRNA, etc.) for S. Cerevisiae but we don'w have one for Pombe. I'm wondering which database I can download that? Thank you very much for your help.

ribo-seq pombe fasta rrna cleaning
• 2,808 views • link
updated by GenoMax GenoMax • written by hdmagpantay • hdmagpantay

2 answers

I am not sure about the specific organisms but it'd be worth looking at SILA rRNA databases: https://www.arb-silva.de/

• 0 views • link
written by Sej Modha Sej Modha

You should be able to find all data you need from Ensembl Pombe page. GFF3 file has the locations for all rRNA/tRNA etc. Fasta genome sequence is also available from this page.BEDtools getfasta with this gff3 file should get you sequences you need.

• 0 views • link
written by GenoMax GenoMax

Sorry to revive this old thread. I am trying to make my own rRNA file and the first few lines look like this:

>RNU6-1100P snRNA
ATGCTTGCCTCAGTAGCACACATACTTAAGTTGGAACAATAGAGAGATTGGCACGGCCTCTGTGAAAGAATGACATGCAAATTTGTGAAGCATTCCATATTTTT
>U6 snRNA
ATGCTTGCCTCAGTAGCACACATACTTAAGTTGGAACAATAGAGAGATTGGCACGGCCTCTGTGAAAGAATGACATGCAAATTTGTGAAGCATTCCATATTTTT
>RNU6-1199P snRNA
ATGCTTGCCTCAGTAGCACACATACTTTAGTTGGAACAATAGAGAGATTGGCACGGCCTCTGTGAAAGAATGACATGCAAATTTGTGAAGCATTCCATATTTTT
>RNU6-731P snRNA
GTACTTACTCCAGCAGCACATATACTAAAAAACTGGAATGATACAGAGAAGACTGGCAATGGGCCCCGCACAAGGATAACATATTATTTTTTTTAAGTGATGTAGAACTGT

I built a bowtie2 index with the file but none of my reads are aligning to it. I am certain there are rRNA reads in my file as I downloaded the data and protocol from a publication. They also removed rRNA contaminants with bowtie2, but did not provide the fasta file. Is there something I am missing?

• 0 views • link
updated by GenoMax GenoMax • written by Daniel • Daniel

Log in to answer this question.

More posts like this