Retrieving UUIDs from TCGA Barcodes in the GDC File Repository · Biostar

This is a test version of Biostars. For the public version, visit https://www.biostars.org.

Retrieving UUIDs from TCGA Barcodes in the GDC File Repository

Is there a reliable method for retrieving the UUID of a BAM file that corresponds to a TCGA barcode? I've found that searching by submitter id does not bring up the specific BAM files, and though sometimes the name of the BAM file includes the TCGA barcode, it isn't always consistently like that. I also tried using the TCGA Barcode to UUID Mapping service but it seems that it is no longer supported.

gdc tcga uuid barcode

• 4,746 views • link

updated 8.2 years ago by Kevin Blighe

• written 9.0 years ago by jjdan •

Just look up the barcode at the GDC and take a look at all files possible available under that barcode.

• 1 views • link

written 8.3 years ago by Kevin Blighe

1 answer

A solution for mapping between TCGA Barcode and UUID has been made here: Sample names for TCGA data from GDC-legacy archive

• 1 views • link

written 8.2 years ago by Kevin Blighe

Log in to answer this question.

More posts like this

MAF tools - changing tumor sample barcode name
written 1.6 years ago by Nona •

Good afternoon, I am trying to read a maf file with a clinical data file (from TCGA) via maf <- read.maf(maf = maf_file, clinicalData = …
Tool: UUIDtoBarcode Renaming of Folders
written 3.7 years ago by Kaia •

I've recently been involved in a research project that involves taking datasets from the National Cancer Institute, GDC Data Portal. The Methylation and RNA-seq dataset …
Why does TCGA RNA-seq pipeline starts from a BAM file?
written 4.6 years ago by シン •

I am trying to do exactly the same pipeline for RNA-seq data process as the TCGA does. Usually when we ask a sequencing service, we …
Will mapping Read 1 in Single Cell 3' sequencing increase mapping accuracy or not?
written 5.4 years ago by Zhilong Jia

Why lots of pipeline of 3` sequencing (such as [zUMI][1], [scruff][2]) do not map Read 1, including barcode and UMI, as PE mode mapping? Though …
Count pooled sequencing barcode in fastq
written 6.1 years ago by vinaykusuma •

I have a fastq file where each read has a barcode, each barcode corresponds to a individual. barcode resides in the middle of the read. …
trying to get TCGA Sample ID (legacy barcode style sample_id) associated with downloaded files
written 6.6 years ago by markddesimone •

Hi, This summer I downloaded a few transcriptome files from TCGA. The file list contained the legacy barcode style sample ids, e.g. TCGA-IN-7806-11A e.g. ``` …
bcftools variant calling query
written 7.0 years ago by f1978hp •

"During variant calling bcftools compares the average mapping quality of reads supporting a variant with those they don't. If there is a significant difference it …
Removing primer and a variable length adaptor/barcode sequence from .fna file
written 8.0 years ago by caverill •

I have a set of sequence files, where individual sequences look like this: GACTACACGTAGTATATCTAGCGACTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGAAAAATGGGGGTTCGTGCAGGTGCCGCCCGGGGTCGTGTAGCGAGGAGTATTACTACGCTTAGAGCCCGGCCGTACCGCCACTGCTTTTGTAGGCCCGCCAACCGGCGGTGCCCAACGACCCAGCGAGCTGGATTGGTTATAATGACGCTCGAACAGGCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTACGTTCTTCATCGATGACGAGATACTAGGTGTGGTCGGCGTCTCTCAAGGCACACAGGGGATAGG There is a primer sequence that has a few variable positions: …
Count mismatchs/Indel number per position in BAM file ?
written 9.1 years ago by Chadi Saad

how to count mismatchs number at each position in BAM file ? I found BAM-readcound, but it seems that the bug isn't solved yet : …
Tophat Error: Bam2Fastx Failed To Open Bam
written 13.9 years ago by user

<p>I ran Tophat and near the end of the run it gave the following error:</p> <pre><code>[2012-09-28 15:51:58] Mapping left_kept_reads.m2g_um to genome mm9 with Bowtie [2012-09-28 …