Hi, I have fasta sequences from sample that includes spike-in controls. How can I align those spike-in with the database using bowtie2 and filter them to create mapped reads of FASTQ files. Any references or scripts to perform the Task would be appreciated. Thanks
Depending on how long and specific your spike-ins are, I recommend using BBMap's Seal which can both remove and quantify them using kmer-matching. For example:
seal.sh in=reads.fq ref=spikeins.fa pattern=spikein_%.fq outu=clean.fq stats=stats.txt k=31
Hi swbarnes2, I prepared a new *.fa file with all the sequences of spike-in as shown below
UniSP100
TCCCAAATGTAGACAAAGCA
UniSP101
TGAAGCTGCCAGCATGATCTA
UniSP102
CAGCCAAGGATGACTTGCCGG
Would you be kind enough to send me the script for Bowtie2 provided my test sequence is B12_015.fastq? Thank you very much
With such short sequences, I think kmer-matching will probably work better than alignment... are those the full length of the spike-ins?
In that case, if you decide to use Seal, change the flag "K=31" to "k=20" or whatever the length is of the shortest spike-in. And you may want to allow a substitution with the "hdist" flag, e.g.
seal.sh in=reads.fq ref=spikeins.fa pattern=spikein_%.fq outu=clean.fq stats=stats.txt k=20 hdist=1
Log in to answer this question.
