My goal is to use STAR to create a new genome with the spike-ins listed below by combining both hg38.fa and spike-in. Once I have the genomes created, I'll align FASTQs to this newly created genome and use samtools (or another tool) to count the number of reads mapped to each spike-in for each sample. Would anyone know how to use samtools in this case?
Spike-in 150bp:
AGGCTTTGTTATTGGTATTGACTTACAAACAGTTAAGCCATTTGAATATGATAATGTAGTTGCAATAAAAGGAGATTTCACCTTAGAAGAAAATTTGAACAAAATTAGAGAGCTAATTCCAAATGATGAAAAAAAGGTGGATGTGGTTAT
Spike-in 250 bp:
ACGATAAAATTGGTTTTGCCTTTCAGCAATTCAACTTAATTCCTTTATTAACTGCCTTAGAAAATGTTGAACTTCCACTGATTTTTAAATATAGGGGAGCAATGAGCGGAGAAGAGAGGAGGAAGAGAGCTTTAGAATGCTTAAAGATGGCAGAGTTGGAGGAGAGATTTGCCAATCACAAACCAAATCAGTTGAGTGGAGGGCAACAACAGAGAGTTGCTATAGCGAGGGCTTTGGCAAACAACCCACC
Spike-in 350 bp:
CACCTGTCACATTTCCAATCGGCTCCAGGAAGAGAGAAGTGACGGCTTGATCCTGTAGTAATCCGGGATCGACTTAAGGGGTGCAGCGACCACGGCGGATCGGGCGTCGCAATAGTCCTCCTGTTAGGAGGGTCCTTCTAATGTTAACGCCCGAATATTAGTCATATTTTGCTAGCGCCTATCAGCGTAAGATATGATTTAAGTTACACCAGGAGAGTAGCGAGATAGAACCACTCGTTGGATCGGTCTTTCTTAATTGACTACTATCAGATCCGGCGCATGGCGCTGAGGTCAAACTACATTACAGGCCCTGGTTTCCATGGGTCAGCGCAAGTACAGGCGAGCAGATA
Spike-in 450 bp:
CACAAGAATCCCTGCTAGCTGAAGGAGGGTCAAACTATAACACCTTTAGCATTCGTACAGGCAGGCTAAGTGAATACTAACCCACCGGCAGCCCGTTGTAGTAACGTTGACCCCTGGCTCGGAGACATTTGGTGTTGCCTAGTACTAGGTGACTGGTACCGATTCATAGGTTCGCCATTCTCTTATCGAGAGCCCGAGGTAGACTATCTTCCAGATGATGCCATACGTTCACTCAATCGCGCGGCATGCACGGTGGGGCTACGAACTTGCTATCCATAGGCTCTAGATGTGGTAGAAATATGCTGCAGGGGTTCTGTCGAATTTGCTCGGCAACCGTGGCCGTGTATGCTTTCATATCCCGGCGGTGTGATCTAGCCTTCTCGCCATATGAGGGCGCTGAGCATAGACCCAAACCCGACTAGTCGAATCTTAGGGTTGTATGCTAGAACG
•
written
by
kstangline •
1 answer
You can do what GenoMax suggested but I would recommend an alternative that fits with RNA-Seq workflows. Use an annotation information usually in the form of the GFF file that comes with your spike data (or create a file like that) .
Now treat your spike as if it were another gene on the genome and incorporate it into the entire process. You'll be able to validate the statistical process's powers that way.
Basically instead of samtools use a tool like featureCounts to count the reads that span over a region. The counting tool is designed to count reads and will provide you with additional utility that you will likely need later on.
Log in to answer this question.
-
Estimate large insertions size in WGS data.
written by meetmet •
-
Extract human, mouse and pig aligned reads from .bam file alignment to conactenated genomes
written by daewowo •
-
GO Term analysis
written by snehu.sambare •
-
Two bams with similar flagstat output have very different file size
written by freeheart.steven •
-
Assembling Short Sequence
written by joseph.landry •
-
what's the difference between picard MergeBamAlignment and samtools merge
written by Yingzi Zhang
-
Does Last aligner only outputs the mapped reads to a bam file ?
written by pinn
-
How realible samtools/ bam-readcount /igvtools /pysamstats for finding deletions/insertions?
written by IrK
-
reference-guided genome assembly: stretches of Ns
written by User 4014 •
-
How To Figure Out The Base On The Special Positions
written by camelbbs
Add the spike-in's as individual references in your genome file. After alignments, use
samtools idxstatsto get reads aligned to each of the spike-ins from BAM.