This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Mismatch and Indel statistics from BAM/SAM file

I am trying to find some statistics of mismatches and indels from SAM/BAM file. The SAM file is generated using BWA. The statistics should include the %mismatch and %indel for each aligned reads. I am wondering if there are any good tools I could use.

sam bam indel
• 14,991 views • link
updated by FatihSarigol FatihSarigol • written by BDK_compbio BDK_compbio

3 answers

You can also try alfred. It needs a sorted & indexed BAM file and the reference genome you used for the alignment.

alfred qc -r <reference.fa> <align.bam>

It computes the error rates you are looking for and some other metrics (insert size, coverage, ...).

• 0 views • link
written by trausch trausch

Is there an executable? I am getting error while compiling.

• 0 views • link
written by BDK_compbio BDK_compbio

Yes, there are statically compiled binaries available here and we did run it previously on Nanopore, Illumina and PacBio reads but if you experience any problems please let me know.

• 0 views • link
written by trausch trausch

It worked fine except the BAM files generated by LAST

• 0 views • link
written by BDK_compbio BDK_compbio

Looks nice, did you announce it at the Tools section?

• 0 views • link
written by h.mon h.mon

Thanks, I have not created a Tools page in Biostars but there is a fairly extensive README on github.

• 0 views • link
written by trausch trausch

metrics.tsv should contain all the statistics, right? I am having hard time to read that file. Would it be possible to make it a text file that should contain like the following

....
.....
#Mapped             196263
MappedFraction  0.31431
#MappedRead1    196263
.....
.....
• 0 views • link
written by brs1111 • brs1111

It is a tab-delimited text file. You can use datamash to convert it to row-format:

cat outprefix.metrics.tsv | datamash transpose | column -t

The column-format is useful if you want to compare statistics across multiple samples because you can just concatenate the metrics files.

• 0 views • link
written by trausch trausch

Thanks for your alfred tool. I have computed the mismatch rate and error rates of my long-read alignment. Mismatch rate seems to be number of mismatches / number of aligned bases. How do you define the error rate? I have an error rate of 11.4%. What does that mean? And how do you define the insertion and deletion rate? Is one wrong insertion counted as one and then you divide the total by the number of aligned bases? If there are two consecutive wrongly inserted bases, do you count that as two errors? Thanks.

• 0 views • link
written by biomagician biomagician

The InDel size doesn't matter as discussed in this Alfred issue.

• 0 views • link
written by trausch trausch

BBMap's Reformat tool can produce some of these statistics:

ehist=<file>            Errors-per-read histogram.
qahist=<file>           Quality accuracy histogram of error rates versus quality score.
indelhist=<file>        Indel length histogram.
mhist=<file>            Histogram of match, sub, del, and ins rates by read location.
ihist=<file>            Insert size histograms.  Requires paired reads interleaved in sam file.
idhist=<file>           Histogram of read count versus percent identity.

BBMap also prints out a summary of match, mismatch, insertion, and deletion rates when it runs. But I think you can get most of what you want with Reformat, particularly, the mhist output.

• 0 views • link
written by Brian Bushnell Brian Bushnell

Thanks Brian !! So I can use my existing BAM/SAM files with BBMAP? Could you please help me with the right command?

I am trying this

reformat.sh in=mapped.sam ehist=ehist.txt

But I get a blank file.

• 0 views • link
written by BDK_compbio BDK_compbio

That command should be fine. You need to have MD tags in the sam file, but those should be present by default with bwa. I just ran this on a bwa-produced bam file to make sure, and it worked as expected:

reformat.sh in=502930_1127296.bam ehist=ehist.txt
java -ea -Xmx200m -cp /global/projectb/sandbox/gaag/bbtools/jgi-bbtools/current/ jgi.ReformatReads in=502930_1127296.bam ehist=ehist.txt
Executing jgi.ReformatReads [in=502930_1127296.bam, ehist=ehist.txt]

Set error histogram output to ehist.txt
No output stream specified.  To write to stdout, please specify 'out=stdout.fq' or similar.
Found samtools 1.4
Input is being processed as unpaired
Input:                          18069294 reads                  1824440174 bases
Output:                         18069294 reads (100.00%)        1824440174 bases (100.00%)

Time:                           38.741 seconds.
Reads Processed:      18069k    466.41k reads/sec
Bases Processed:       1824m    47.09m bases/sec

Contents of the file:

#Errors Count
0   16190186
1   1414068
2   197871
3   65303
4   31407
5   18726
6   12160
7   8348
8   5873
9   4199
10  2797
11  1875
12  1266
13  742
14  422
15  166
16  40
17  1
18  1

Note that you can write all the histograms at once if you want. Can you run "tail" on the sam file so I can see what a few reads look like?

• 0 views • link
written by Brian Bushnell Brian Bushnell 
0d6893dc-57eb-4eaa-a1ad-406b4528cc6f    0   c12692/f5p5/989 132 60  10S12M1D30M2I9M1I6M2D39M1I10M2I6M1D17M1D12M1D1M2D11M1D10M1I12M1I67M4I21M2D24M2I11M3D18M1I24M1D26M1D11M5D26M1I8M1D2M1D22M1D4M2D25M1D8M1D2M2D33M1D15M4I12M1D22M2I23M2D6M1D4M2D10M1I25M3I5M3I2M1I7M1I22M4I10M3I11M6I4M1I11M1I5M2I4M2I3M1I4M3I3M2I1M4I8M1D7M1I11M2I7M1I17M2I6M1I5M1I1M1I2M2I8M5I24M51S  *   0   0   CATTACGGCCGGAGGGGCAAGCAAAGATTGTGCTCAAGTTGCCCCTGGATGACCCGAGAGGAAGGAGGAGAGGCCTTTCAGGCTGCTGTGGGAATGAACGGTGTGACATCCCGCCACGATGCGGAGGGGACAAGATCGTCGTCGTGGCGACGGCGTCATTATCACGCTCCCACAATAATATCAGCGCAGCCTCCGGCTTTACGGAGCTGCTCAGCGTCAGCTCCGGCGACGACAAGAAGAAGGGCATTGGGTATGGCTACTGCAGGGAGCAGCGGTGGCATGATGCAACGGCGGTGGCAAAGAGGGCAACGGGAGAGCAAAGGCAGCGGCGGTGGTGGCAGAGAGCAGTGGAGGCTACGGCGGCCGTACCAGGCGATGCCGCCGGTCTCATCCCTGCCTACCTGCAACGCCATGCCGTCGTCCTACCCACTGCGTCTCTCTATCCTGCAGCATACCCGCAGAACAAGGACCCTGGATGCAGCATCATGTGAAAAACATCTACGTTAATCTGAGGAGTTGATTGAAGGTGGCCGAAACATGGAGATCAGATGAATTAACATGGTTGATTCGTCAGGACAAGATGATCCACATGCTGCCTTGAGCTGTGCAACAGGACGTGGTGGGATGTGATCGCCCAGTTGTGAACATTATCATCCGTTATGGAATCTATCAATGTGCAAGGGTTGGCCAACAAACTTGACAGATGGATGAGGTGATTAGAACAAGGTTTACAGCTGAAGGAGTGGAGGCGTTTGTTGCGCCTTGTGAGTTCAAAGAGTTGGACTTCAAATTAATAGCGGCAAACGGTGTTTCTATTTTTCGTTTTCTTTCGGTTTTGGTGGAAACAAGGTTGTGAGGTCAGTTTGTTGGAAGAAAGAAAAGAAAAGAAAGAAAAAGAAAAATATCTCGAAAAGAAAAGAAAAGAAGATGGAGCGACAGACCGTGGGTT   *   NM:i:170    MD:Z:3T8^A45^GA7C0A28G17^C17^C12^G1^CC0C0C9^A1A2C2G0C1C1G14A0C0G44G0A0C18G14^TA1G0G32^AGA2G39^A0T23G1^A11^AGCAG1A25G0C5^A2^C22^C2G1^AC25^A8^C2^AC33^A27^G1G43^AG4T1^A2A1^CC0A11T0T8G14T4T4A12G14T5G5G0A40G1C3^G4A3G1A7C15T37G1T0T1C2T4T2    AS:i:524    XS:i:27
d6da0f06-2394-4203-9190-057434731910    0   c74405/f20p10/1109  181 2   12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I5M1I9M2D9M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M1I13M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I14M1I10M2I5M54S   *   0   0   CATTACGGCCGGGGGACACGCAACAGTCAGGGAGGAGGACGGGCGGCGGCGGCTGGAATCCAGCTCAAGCGTCTGGGTCCTTCTCACCCGCTGTACCGTCCCTCAGGCAGCATGCATGTGCCTCACCCTATGCTCCCACGCTGGCCTTCTCTGCGCTTGGTGCATACCTCACATCCTCCTCAACGTCAGGCACCCTCACGACCATGGGATGCTGGCCTCCATCCTTCCCTCATCTCCTGCCCTTGCAGGAAGGAACCACTTCAGCAGCTGCTCATATCTGCCTTGCTCCTTCCAAGGCGCGTCATTTGGCCCCCGCTCGTCTGACGCACATTTATTGACTTCGATCAGGGATTCTTGTCACGGCGTTTGTCAGGAACAGCGGTTGCTTTTGGATGCTTCTCTGGCTGCCATCATCGCCAAGCGCAAGAAATTACCTGTACCTCGGCAGTCTCTTTTGCTTCATCTTCTGGCCTCTCCATTCTTCTCTGGCTGTGCAGCTTTTCCGCTGATCTTGTGCACCAACACGACCTTCATGTTTTGAGCTCTACCTGGGCCTCCTGGACTTTTTGGATATATAGTGTTTGTACCCAGGAGATCATCAGGAGGGCGCACCCAGGGGACCTGGACACATCAGAGCGCGCCTTTGACTCTCATCCTGGGGCTTCGTTGCGGTTCTTGTTCAGATCCTTGTCACAATCCATGATGGAAGAGTGCACAGGAGAATCAGAGACAGGAAGGAAGAGGAAGGGCGGTCTTCACTGGATGGATGGATGGCTGGGATCTGAGAACTATGTTTATTGGGGTCCACTACTACTACTTTCTACTACTAGTGCACCATGTACTCACCAATCCTATAATGCTGTATGCCTACACTAAAGAGACAAGAGAGCTTTGAGCGTAATATTCGATGACTATTTGGGGATAGATATTTTAGTTCTGCACTGTTAAAATCATCAAAATCGTCAAAAAGAGAAGGAATGATGGGAGGCGACAGATAGCA    *   NM:i:192    MD:Z:11^TCG4G1^A23^T24^A1A13G1A5A1C0T0C0A1A7A16G31^C18^GG18A5^C12^G1C1T8^C6^CG3^CACGG1^AC5^G7G15G6G0C18C0G18T1^G15C1^A28G2A22^GC23G0G1G15G10A33G1T0A2^TC0A5T0G1^CCA7G36T0T2^C0C1G8G7^A0C15G0A11G0G6A5^T9A3G0C9T1A0C0C1A20G0A22A10^A4C1^A4G0A13^A4T1A0G0C0T0G3A3A1^T6A1^A0C1A2^CAAC2^T12G20G23T0G6G1A15^C16A1G1G1^A0C8G5A2G0A6G11    AS:i:527    XS:i:522    XA:Z:c18552/f2p10/1085,+123,12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I8M1D16M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M3I1M1I9M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I14M1I10M2I5M54S,194;c76099/f2p9/973,+63,12S11M3D3M1I3M1D23M1D7M2I17M1D35M2I18M1I34M1D18M2D24M1D12M1D12M1D6M2D3M5D1M2D5M1D12M1I2M1I25M1I17M2I10M1I3M3I3M1D17M1D23M1I31M2D21M1I25M5I5M2I28M2I8M1D16M3D19M1I29M1D19M1D43M1D6M1I6M1I11M1I39M3I2M1I6M1I16M1D6M1D9M1I10M1D20M1D8M1D5M4D2M1D3M1I7M1I10M1I12M3I1M1I9M2I10M2I10M1I8M3I2M2I8M1D2M1I4M1I12M1I4M1D9M1I17M69S,190;
• 0 views • link
updated by GenoMax GenoMax • written by BDK_compbio BDK_compbio

I am still getting a blank file. Please check the last two lines of sam file

• 0 views • link
written by BDK_compbio BDK_compbio

Is d6da0f06-2394-4203-9190-057434731910 an ID from Nanopore or some other sequencing tech?

• 0 views • link
written by GenoMax GenoMax

Yes, it is from nanopore. I am trying to align naopore reads against both illumina and Pacbio contigs

• 0 views • link
written by BDK_compbio BDK_compbio

Is this the mismatch profile for every read or the error rate that is originated from the sequencing? Thanks!

• 0 views • link
written by Dogancan • Dogancan

Log in to answer this question.

More posts like this