Error: reads file does not look like a FASTQ file
I am trying to use bowtie tool to align ecoli paired end reads. My files extension is .fq. The reads look like
@r0/1
TATTCTTCCGCATCCTTCATACTCCTGCCGGTCAG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r1/1
TGATAGATCTCTTTTTTCGCGCCGACATCTACGCC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r2/1
CACGCCCTTTGTAAGTGGACATCACGCCCTGAGCG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r3/1
CGATGCAGATGCGTACCACCTGGACCAGGCCTTTC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
and I think the reads are in fastq format. But I get the error: on using the following command
bowtie index -1 file1 -2 file2 output
Error: reads file does not look like a FASTQ file
I am not sure what is going wrong.
1 answer
Since you are trying to index a genome you need to provide a fasta genome reference (not R1/R2 data files). The reference genome file included is in bowtie/1.2.0/src/bowtie-1.2/genomes/NC_008253.fna in bowtie package. That said, the package also includes premade indexes in /bowtie/1.2.0/src/bowtie-1.2/indexes/.
The reads file looks like it has issues, if you see the qualities they all are the same even if the bases called are different.
• 0 views
•
link
written
by
Matteo Schiavinato
Log in to answer this question.
More posts like this
-
How to run MLST with multiple fastq files
written by Kumar
-
Bowtie: Mate files mapping error
written by priya.dalvi •
-
Shovill batch assemblies
written by jellila •
-
What to do with read sequence quality
written by AHW •
-
What to do with read sequence quality
written by AHW •
-
How to get percentage of reads mapped to each Reference Genome
written by bandanaschapagain •
-
Error with SRA downloaded reads and SPAdes 3.1.0
written by jlimenitakis •
-
Error using "timecourse" package for microaaray data.
written by unique379
-
How To Perform A Nested Anova Analysis When Groups Have Unequal Number Of Samples
written by The
-
Converting Gene Expression Omnibus Format To Fasta
written by Click downvote
Looking at the Bowtie source code here, this error is thrown whenever the first non-empty line does not start with '@'. Are you sure this is what your FASTQ files look like?
I don't think this is a real file, the quality values are all identical. How was the input generated?
About input generation, I am not sure, but the ecoli reads come with bowtie software package.
I think you have to paste the real file content and the real command, because there is where we can spot problems! This looks like a dummy file (qualities are identical and read names are not as they usually are -> coded depending on the technology). Moreover, the command as you wrote it looks correct in syntax but we have to see the real one to understand!
Above show command is real and the reads are paired end reads given as sample dataset in bowtie software package.
@as read name is used by illumina technology.Please provide the full command and possibly also your real input and the error message.
Hello hussain.kh438!
We believe that this post does not fit the main topic of this site.
Cannot reproduce
For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.
If you disagree please tell us why in a reply below, we'll be happy to talk about it.
Cheers!