fastq and bam files
How to? Using the following alignment entry from a BAM file reconstruct the equivalent FASTQ entry.
ILLUMINA-EAS45_6:1:1:3:2025:0:1:1 0 chr1 115679594 255 36M * 0 0 AAGCACAGGACTATTCTGTCTCATTTTCCAAATAGA ABCABBBCB@@CBCB?B@B?BA@A?A>=68999:59 XM:i:0 NM:i:0 MD:Z:36
• 2,747 views
•
link
updated
by
Biostar
•
written
by
smithjamie1 •
•
written
by
smithjamie1 •
1 answer
Unless this is homework, where you have to write code yourself to do this, there are existing tools that will do the conversion, such as Picard tools SamToFastq, https://broadinstitute.github.io/picard/command-line-overview.html#SamToFastq.
Log in to answer this question.
More posts like this
-
No cell barcode information in BAM files.
written by bill •
-
Consensus deduplication issues with non-matching/'slippy' primers?
written by graeme.thorn
-
bowtie2 '-a' does not return all alignments
written by shim •
-
do paired end reads both mapped to the same gene appear consecutive to each other in SAM file (usin…
written by Moses
-
bedtools multicov - tab-delimited bam files?
written by susibing •
-
Extract unique and multimapped reads from bowtie 1 sam/bam output
written by Konstantinos Yeles
-
Bowtie2 aligner not generating .sam file.
written by Ramana •
-
Can't convert paired end BAM to bed using bedtools
written by colin.kern
-
Issue with naming convention in bedtools
written by A. Domingues
-
ZeroDivisionError: float division by zero, from "methratio.py" in BSMAP
written by atoogoe •
homework ?
yes, would be great to get some tips. I am familiar with the fastq and usually get my data in the form of vcfs but that is puzzling.
See entries for FASTQ format and SAM format. Should be easily apparent what fields to select from your bam to reconstruct the original read.