This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Issue with naming convention in bedtools

While intersecting a bam file and bed to obtain the total number of reads that map to a class of genes, bedtools outputs the following error:

bedtools intersect -a some.bam -b LINE.bed -sorted -s -wa -bed -f 1.0 -nonamecheck | wc -l

ERROR: File some.bam has inconsistent naming convention for record:
      -1      -1      HWI-ST558:319:HJHNYADXX:1:1101:10003:66276 1:N:0:GATCAG 0       +
137933

I poked around the internet and this appears to occour when chromosome naming conventions do not match. However, the stated solution, option -nonamecheck did not work. The culprit is (at least) this alignment:

samtools view some.bam | grep 'HWI-ST558:319:HJHNYADXX:2:2104:11288:74456'
HWI-ST558:319:HJHNYADXX:2:2104:11288:74456      0       chr4    61813677        0       27M     *       0       0       GACAAATCAAGAAAACCATTAAACAGC     FFFFHHDHFHJJJGIGFFFHGIG@GDH      XA:i:0  MD:Z:27 RG:Z:1  NM:i:0  XM:i:2

Which to me does not appear to be any different from other alignments in the file:

samtools view some.bam | head
HWI-ST558:319:HJHNYADXX:1:1110:11857:4127       0       chr1    5571    255     29M     *       0       0       GCCACATGTGTGGACCAGGTCAACACATA   FFFFHHHHHJJJJJJJJJJIIJJJJJIJJ    XA:i:2  MD:Z:5G12A10    RG:Z:1  NM:i:2
HWI-ST558:319:HJHNYADXX:1:1210:19976:51309      16      chr1    8405    255     27M     *       0       0       GACTCAGTTAGTTTGATCAGTGTGTTT     HCHHGIJJJIJIIIGIIJHGHHHFFDF      XA:i:0  MD:Z:27 RG:Z:1  NM:i:0
HWI-ST558:319:HJHNYADXX:1:2101:16679:94808      0       chr1    13822   255     31M     *       0       0       TTAATTTGCCCTCATAAACTCTGATCAAAGT FFFFHHHHHJJJJJJJJIHJIJJJJJJJJJJ  XA:i:0  MD:Z:31 RG:Z:1  NM:i:0
HWI-ST558:319:HJHNYADXX:1:2209:11460:28507      0       chr1    19815   0       24M     *       0       0       TGACGTTGTGTGGACATTACCACT        DDFFHHHHHJJJJJJJJJJJJJJJXA:i:0   MD:Z:24 RG:Z:1  NM:i:0  XM:i:2
HWI-ST558:319:HJHNYADXX:2:2206:8659:12479       0       chr1    22434   0       27M     *       0       0       TAACCGGCACGGGCTCATTCTGAAAGC     FEFFHDAFHJJDEGBHIIJ>GGCHIJJ      XA:i:3  MD:Z:5A0A3A16   RG:Z:1  NM:i:3  XM:i:2
HWI-ST558:319:HJHNYADXX:2:1116:12702:23989      0       chr1    24671   0       30M     *       0       0       ATAGATATTATCAGACACACTGTGAACATT  FFFFHFHHHJIJIJJJJJJIJJJJIJJFHI   XA:i:1  MD:Z:3A26       RG:Z:1  NM:i:1  XM:i:2
HWI-ST558:319:HJHNYADXX:2:2112:15091:10459      0       chr1    37645   0       29M     *       0       0       CTGTGCAGAGCTGCAGCCCTCAAGGAGTT   FFADDFFDHEGBDD@GIEIGHEGHC8:FG    XA:i:1  MD:Z:21C7       RG:Z:1  NM:i:1  XM:i:2
HWI-ST558:319:HJHNYADXX:1:2101:17286:97920      0       chr1    43096   0       26M     *       0       0       CGGTTTGACTGTACAAGTGAAATACC      FFFDHHHHHJJIJJJJIHIHEIIIJJ       XA:i:0  MD:Z:26 RG:Z:1  NM:i:0  XM:i:2
HWI-ST558:319:HJHNYADXX:2:1108:5430:68222       0       chr1    43273   0       24M     *       0       0       TCGTTGAGAAGAGTAGGGACGGTA        FFFFHHHHHJJJJGHIJJJJIIGIXA:i:0   MD:Z:24 RG:Z:1  NM:i:0  XM:i:2
HWI-ST558:319:HJHNYADXX:2:2207:2908:11814       16      chr1    43750   255     29M     *       0       0       TACGCTTCAGTACGATCACTGATGTTGAT   JIJIJJIJJJJJJJJJJIJJHHHHHFFFF    XA:i:1  MD:Z:9T19       RG:Z:1  NM:i:1

This happens for all 12 of my bam files (mapped to Danrer7, bowtie-0.12.8*). I am a bit at a lost of what is happening here. Bedtools Version: v2.23.0

sam bedtools
• 15,229 views • link
updated by Ram Ram • written by A. Domingues A. Domingues

2 answers

I have spent some more time finding the source of the issue, and it turns to be something simple:

Mapping was done against Zv9 and the bed file contained coordinates from Zv10 - UCSC now has this version as default and I obviously did not pay enough attention (I hang my head in shame). When replacing with the Zv9 bed file the issue is gone.

I would expect that in such a case, the error message would something like '-a and -b coordinates not matching' but the fact that it gives an error is already re-assuring.

• 0 views • link
updated by Ram Ram • written by A. Domingues A. Domingues

I think it's more because the read name contains a space:

 HWI-ST558:319:HJHNYADXX:1:1101:10003:66276 1:N:0:GATCAG

This name should have been trimmed to:

HWI-ST558:319:HJHNYADXX:1:1101:10003:66276

which aligner did you use?

• 1 views • link
updated by Ram Ram • written by Pierre Lindenbaum Pierre Lindenbaum

which aligner did you use?

bowtie-0.12.8. It is a very old version, but I am using it to be consistent with another set of results that someone else produced.

I think it's more because the read name contains a space:

But this seems to be produced by bedtools intersect, rather than by bowtie, because the space is not present in the read name from the bam. Also, bedToBam returns a proper read name:

bamToBed -i some.bam | grep 'HWI-ST558:319:HJHNYADXX:2:2104:11288:74456'
chr4    61813676        61813703        HWI-ST558:319:HJHNYADXX:2:2104:11288:74456      0       +

Actually, I just tested converting bam to bed before intersecting and it does not throw out any error:

bamToBed -i some.bam | bedtools intersect -a - -b LINE.bed -sorted -s -wa -bed -f 1.0 | wc -l

If I am reading this test correctly it might be a bug in intersectBed. I will wait to see if Aaron Quinlan shows up here, otherwise I report it soonish.

• 1 views • link
updated by Ram Ram • written by A. Domingues A. Domingues

But this seems to be produced by bedtools intersect: no because '1:N:0:GATCAG is typically produced by a sequencer see: http://en.wikipedia.org/wiki/FASTQ_format

@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG

EAS139      the unique instrument name
136         the run id
FC706VJ     the flowcell id
2           flowcell lane
2104        tile number within the flowcell lane
15343       'x'-coordinate of the cluster within the tile
197393      'y'-coordinate of the cluster within the tile
1           the member of a pair, 1 or 2 (paired-end or mate-pair reads only)
Y           Y if the read is filtered, N otherwise
18          0 when none of the control bits are on, otherwise it is an even number
ATCACG      index sequence
• 1 views • link
updated by Ram Ram • written by Pierre Lindenbaum Pierre Lindenbaum

Log in to answer this question.

More posts like this