This is a test version of Biostars. For the public version, visit https://www.biostars.org.
is DANN capable of scoring insertion and deletion?

Hello, I have a question for non-coding variants scoring tool 'DANN'(https://www.ncbi.nlm.nih.gov/pubmed/25338716). I got a database from their website and scored SNVs, but are they capable of scoring insertion and deletion, like CADD? Thanks in advance.

snp indel genome annotation non-coding

i have the same question. anyone know detail?thanks for your help!

1 answer

CADD and DANN are built on the same feature set and training data, so, they should both provide scores for short indels. For other tools, see here: A: Duplication Mutation prediction

Kevin

-----------------------------------------------------

Edit (23rd November, 2018):

While CADD provides scores for InDels (see comments, below), it appears that DANN has only used the single nucleotide feature data from CADD for building their own model. Data for DANN available here: https://cbcl.ics.uci.edu/public_data/DANN/data/

Are you sure...? - I think that CADD can score short indels. Unfortunately, even the ANNOVAR author appears to not have the complete picture.

This is stated in the CADD manuscript abstract (important point in bold):

Combined Annotation-Dependent Depletion (CADD) is a widely used measure of variant deleteriousness that can effectively prioritize causal variants in genetic analyses, particularly highly penetrant contributors to severe Mendelian disorders. CADD is an integrative annotation built from more than 60 genomic features, and can score human single nucleotide variants and short insertion and deletions anywhere in the reference assembly.

[source: https://academic.oup.com/nar/advance-article/doi/10.1093/nar/gky1016/5146191]


Indeed, one can download pre-computed CADD scores for indels from here: https://cadd.gs.washington.edu/download

f

Here is some output for InDels with CADD scores:

#Chrom  Pos Ref Alt RawScore    PHRED
1   10001   T   TC  0.330202    5.816
1   10009   A   AC  0.338166    5.913
1   10012   C   CT  0.337480    5.904
1   10013   T   TA  0.337758    5.908
1   10015   A   AC  0.338255    5.914
1   10021   A   AC  0.338339    5.915
1   10027   A   AC  0.338345    5.915
... ...
1   1002436 GA  A   0.075106    2.226
1   1002436 GA  G   0.075106    2.226
1   1002626 AATAGG  A   0.055368    1.994
1   1002636 TCTA    T   0.063638    2.089
1   1002640 C   CT  0.097740    2.511
1   1002640 CT  C   0.056540    2.008
1   1002641 T   TT  0.096215    2.491
1   1002651 TC  T   -0.426068   0.052
1   1002652 CTTTTT  C   -0.034099   1.146
1   1002658 TGAGACGGAG  T   -0.041958   1.088
1   1002949 TCTA    T   0.095886    2.487
1   1003063 G   GC  -0.089841   0.783
1   1003098 A   AG  -0.005848   1.378
1   1003102 A   AC  -0.023024   1.233
1   1003108 CT  C   -0.068722   0.907
1   1003112 T   TCCCTGCC    -0.094796   0.756
1   1003112 TCCCTGCC    T   -0.040014   1.102
1   1003161 TC  T   -0.031602   1.166
1   1003329 GGGGTGGATCCTGGGCTGCA    G   0.551005    8.110

Log in to answer this question.