This is a test version of Biostars. For the public version, visit https://www.biostars.org.
blast database creation error

Am trying to run standalobe blast 2.2.31 version,.

While creating database the following error is popping

"BLAST Database creation error: FASTA-Reader: No residues given"

I read the previous thread addressing the same error, in which they have suggested to run grep command to remove line spacing, i tried that and checked manually too, but still the same error is coming up.

Can anyone suggest a solution for this

blast
• 3,854 views • link
updated by Biostar Biostar • written by itsanju87 • itsanju87

please paste command, and some lines of sequence file

• 0 views • link
written by shenwei356 shenwei356

makeblastdb -in miRNA.fsa -dbtype nucl

Sequence:

>cre-miR1144a.2 MIMAT0005379
UGGAACCGGGCACGCAGGAG
>cre-miR1170.2 MIMAT0005428
AAUCAGCCAAACACGGCAGA
>cre-miR1150.1 MIMAT0005392
AGAGGGACAUUGAUGCGCUGC
>cre-miR1151a-5p MIMAT0005393
UCCGGGGCUCAUAACCUGUUG
>cre-miR1167 MIMAT0005434
GGGGUGUGAUGAUUUGAAAC
>cre-miR1159.1 MIMAT0005437
UGCCACAGUGCCCGAUUGCCG
• 0 views • link
updated by Michael Dondrup Michael Dondrup • written by itsanju87 • itsanju87

There is no problem with the input you pasted. I copy pasted the sequence into a file and makeblastdb works fine. Possibly you have some invisible UTF characters in your file, that were removed, or you have pointed to a wrong file, etc. However I am unable to even produce this error message by messing with any fasta input file. So you might have to post the complete file. 

makeblastdb -dbtype nucl -in tmp.fa


Building a new DB, current time: 02/15/2017 09:24:54
New DB name:   tmp.fa
New DB title:  tmp.fa
Sequence type: Nucleotide
Keep Linkouts: T
Keep MBits: T
Maximum file size: 1000000000B
Adding sequences from FASTA; added 6 sequences in 0.00838804 seconds

.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Remember to use option -task blastn-short when calling blastn with very short query/subject sequences.

And do you really want to "BLAST" something against such short sequences, maybe you want "mapping".

• 0 views • link
written by shenwei356 shenwei356

I want to identify homologs for my input sequence against the database of known miRNAs.

I tried using task-blastn-short command

But getting error as "task is not recognised as internal or external command"

• 0 views • link
written by itsanju87 • itsanju87

See my comment about the need to upgrade your copy of blast below.

• 0 views • link
written by GenoMax GenoMax

In recent version 32 bit executable file is not there because my system is 32 bit

• 0 views • link
written by itsanju87 • itsanju87

In the older version itself the above said command is running.

• 0 views • link
written by itsanju87 • itsanju87

It's not in FASTA format. It should be like this:

>cre-miR1144a.2MIMAT0005379
UGGAACCGGGCACGCAGGAG
>cre-miR1170.2 MIMAT0005428
AAUCAGCCAAACACGGCAGA

Please click the 101010 button to format code or file content.

By the way, remember to use option -task blastn-short when calling blastn with very short query/subject sequences.

And do you really want to "BLAST" something against such short sequences, maybe you want "mapping".

• 0 views • link
written by shenwei356 shenwei356

I reformatted the example but it looks like it is in ok fasta format.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Yes > makes blockquote. However, we cannot move comments to any position. We can only move an answer to a comment on the top level or move a comment to an answer, if it was that you were asking. That is unfortunate, but you can make a new comment and delete the old one.

• 0 views • link
written by Michael Dondrup Michael Dondrup

Can you also try to upgrade to a newer version of blast? Blast+ is currently at v.2.6.

• 0 views • link
written by GenoMax GenoMax

Hello itsanju87!

We believe that this post does not fit the main topic of this site.

Error cannot be reproduced, input data seems ok.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link
written by Michael Dondrup Michael Dondrup

0 answers

No answers yet.

Log in to answer this question.

More posts like this