Question: how to determine seed if sample share a seed <=value
0
Entering edit mode

Hi all!

I'm doing alignments on sequences trying to determine if the seed is <= 65 between each other. My approach was to compare all sequences between each other and look at the csv file

for i in `ls ./ | grep .fasta$`; do echo $i;bwa mem -k 65 all-sequences.fasta $i > $i.sam;samtools view -bS $i.sam > $i.bam;samtools sort -T $i.k50.bam_sorted -o $i.bam_sorted.bam $i.bam;rm $i.bam $i.sam;samtools index $i.bam_sorted.bam;samtools idxstats $i.bam_sorted.bam > $i.csv;done

The problem is if I put a control in my sequences (sequenceX which contains more than 65 sequences in common with sequence1) I got a match only on sequence X (and not on sequence X and 1). The same if I check 'all-sequences' csv file: 1 match instead of 2 for sequence1 and sequenceX

What can be my problem??

Thank you for your help!

Here is a sample of my sequences

>sequence1
CAATACATATCAACTTCGCTATTTTTTTAATAATTGCAAATATTATCTACAGCAGCGCCAGTGCATCAACAGATATCTCT
ACTGTTGCATCTCCATTATTTGAAGGAACTGAAGGTTGTTTTTTACTTTACGATGCATCCACAAACGCTGAAATTGCTCA
ATTCAATAAAGCAAAGTGTGCAACGCAAATGGCACCAGATTCAACTTTCAAGATCGCATTATCACTTATGGCATTTGATG
CGGAAATAATAGATCAGAAAACCATATTCAAATGGGATAAAACCCCCAAAGGAATGGAGATCTGGAACAGCAATCATACA
CCAAAGACGTGGATGCAATTTTCTGTTGTTTGGGTTTCGCAAGAAATAACCCAAAAAATTGGATTAAATAAAATCAAGAA
TTATCTCAAAGATTTTGATTATGGAAATCAAGACTTCTCTGGAGATAAAGAAAGAAACAACGGATTAACAGAAGCATGGC
TCGAAAGTAGCTTAAAAATTTCACCAGAAGAACAAATTCAATTCCTGCGTAAAATTATTAATCACAATCTCCCAGTTAAA
AACTCAGCCATAGAAAACACCATAGAGAACATGTATCTACAAGATCTGGATAATAGTACAAAACTGTATGGGAAAACTGG
GCAGGATTCACAGCAAATAGAACCTTACAAAACGGATGGTTTGAAGGGTTTATTATAAGCAAATCAGGACATAAATATG
TTTTTGTGTCCGCACTTACAGGAAACTTGGGGTCGAATTTAACATCAAGCATAAAAGCCAAGAAAAATGCGATCACCATT

>sequence2
TGCGCAAGAAGGCACGCTAGAACGTTCTGACTGGAGGAAGTTTTTCAGCGAATTTCAAGCCAAAGGCACGATAGTTGTGG
CAGACGAACGCCAAGCGGATCGTGCCATGTTGGTTTTTGATCCTGTGCGATCGAAGAAACGCTACTCGCCTGCATCGACA
TTCAAGATACCTCATACACTTTTTGCACTTGATGCAGGCGCTGTTCGTGATGAGTTCCAGATTTTTCGATGGGACGGCGT
TAACAGGGGCTTTGCAGGCCACAATCAAGACCAAGATTTGCGATCAGCAATGCGGAATTCTACTGTTTGGGTGTATGAGC
TATTTGCAAAGGAAATTGGTGATGACAAAGCTCGGCGCTATTTGAAGAAAATCGACTATGGCAACGCCGATCCTTCGACA
AGTAATGGCGATTACTGGATAGAAGGCAGCCTTGCAATCTCGGCGCAGGAGCAAATTGCATTTCTCAGGAAGCTCTATCG
TAACGAGCTGCCCTTTCGGGTAGAACATCAGCGCTTGGTCAAGGATCTCATGATTGTGGAAGCCGGTCGCAACTGGATAC
TGCGTGCAAAGACGGGCTGGGAAGGCCGTATGGGTTGGTGGGTAGGATGGGTTGAGTGGCCGACTGGCTCCGTATTCTTC
GCACTGAATATTGATACGCCAAACAGAATGGATGATCTTTTCAAGAGGGAGGCAATCGTGCGGGCAATCCTTCGCTCTAT

>sequence3
ATTTCTGAAAATTTGGCGTGGAATAAAGAATTTTCTAGTGAATCCGTACATGGCGTTTTTGTACTTTGTAAAAGTAGTAG
CAATTCCTGTACTACAAATAATGCGGCACGTGCATCTACAGCCTATATTCCAGCATCAACATTCAAAATTCCTAATGCTC
TAATAGGTCTTGAAACCGGCGCCATAAAAGATGAACGGCAGGTTTTCAAATGGGACGGCAAGCCCAGAGCCATGAAGCAA
TGGGAAAAAGACTTAAAGCTAAGGGGCGCTATACAGGTTTCTGCTGTTCCGGTATTTCAACAAATTGCCAGAGAAGTTGG
CGAAATAAGAATGCAAAAATACCTTAACCTGTTTTCATACGGCAACGCCAATATAGGGGGAGGCATTGACAAATTCTGGC
TAGAAGGTCAGCTTAGAATCTCAGCATTCAATCAAGTTAAATTTTTAGAGTCGCTCTACCTGAATAATTTGCCAGCATCA
AAAGCAAACCAACTAATAGTAAAAGAGGCAATAGTTACAGAAGCAACTCCAGAATATATAGTTCATTCAAAAACTGGGTA
TTCCGGTGTTGGCACAGAATCAAGTCCTGGTGTCGCTTGGTGGGTTGGTTGGGTAGAGAAAGGAACTGAGGTTTACTTTT
TTGCTTTTAACATGGACATAGACAATGAGAGTAAATTGCCGTCAAGAAAATCCATTTCAACGAAAATCATGGCAAGTGAA

>sequenceX
ATTCAATAAAGCAAAGTGTGCAACGCAAATGGCACCAGATTCAACTTTCAAGATCGCATTATCACTTATGGCATTTGATG
CGGAAATAATAGATCAGAAAACCATATTCAAATGGGATAAAACCCCCAAAGGAATGGAGATCTGGAACAGCAATCATACA
CCAAAGACGTGGATGCAATTTTCTGTTGTTTGGGTTTCGCAAGAAATAACCCAAAAAATTGGATTAAATAAAATCAAGAA
TTATCTCAAAGATTTTGATTATGGAAATCAAGACTTCTCTGGAGATAAAGAAAGAAACAACGGATTAACAGAAGCATGGC
TCGAAAGTAGCTTAAAAATTTCACCAGAAGAACAAATTCAATTCCTGCGTAAAATTATTAATCACAATCTCCCAGTTAAA
AACTCAGCCATAGAAAACACCATAGAGAACATGTATCTACAAGATCTGGATAATAGTACAAAACTGTATGGGAAAACTGG
Entering edit mode
0

thanks for the answer!! Is there a smart way to highlight all the auxiliary tags if I have numerous sequences to compare?

ADD REPLYlink 3.0 years ago
vmicrobio
• 240
Entering edit mode
0

I guess it depends on what you mean by highlighting. In general, I'd suggest a programmatic solution to something like this.

ADD REPLYlink 3.0 years ago
Devon Ryan
90k
2
Entering edit mode

Note the MAPQ and XA auxiliary tag, which is XA:Z:sequence1,+161,480M,0; in this case...

ADD COMMENTlink 3.0 years ago Devon Ryan 90k

Login before adding your answer.

Powered by the version 1.8