ncbi blast results in multi-sequence fasta file
I have a fasta file that has 1000s of sequences, i.e.:
>loc.1
ATGGTTTTTCCGTATACTTCACTGACTGCTGCTTGTAATTTTTCAGCATCCTCAAATTTTCAATTGTCAGAAACATGTCTAAACAATGAGGTCCCTCCAGTATTTATAAATAGCAACGGCCAAAATTGTTCCCGGCCCAATATGTCTTATAATGCTGACTTTCAAGTTTCAAATAGTCATTGTAATGAAACCACTGACAGTATTGGTAGTGGTCAAAATACTACTACTGATATGAATTACGATCCAAATAATAGTCAGAACTTTTCATTTTCCTCAAATGTTCTTGGTAATCTACAAAACTGGAATGGTAAAAGATCTAATTATTTCAGTTACAAACTCAATGACATGAAACAATTTTATAATCAAGAAATACCGTTAGTGGACAATTCCGTACCGATTTACACAAATGG
>loc.2
CAGGTAAAAATCTGGTTTCAAAATCGTCGGTCCAAGTATAAAAAGCTTATTAAGCAAGGTCAGGATCCAAGCATCCTGATGAATGGAGAATTTAATGACAGCATGGATGAAATGACGGAAGATCAAATCGACGAAGATAATTGTATCAAACCAAAAGCAGAAATGCTATTAACAAGCGATCCAAATAATCCTAGAGGCGATAGTTCTGATATTCCAACTGAAA
I am using ncbi blastn in terminal against this file to search for a sequence of interest. However, I simply want to print out the top 5 hits. Instead, it goes through each locus id and makes an alignment. How can I do this easily - there does not seem to be any options available in blastn to give only the best scoring hits in a multi-sequence file?
• 2,262 views
•
link
1 answer
You can customise the number of alignments by customising following parameters in BLASTN output.
-num_descriptions <Integer, >=0> Number of database sequences to show one-line descriptions for Not applicable for outfmt > 4 Default = `500' * Incompatible with: max_target_seqs -num_alignments <Integer, >=0> Number of database sequences to show alignments for Default = `250' * Incompatible with: max_target_seqs
• 0 views
•
link
Log in to answer this question.
Blast options should apply to each search individually. Is
-num_descriptions 5 -num_alignments 5not working? How did you make your index (using the file example you have posted)? Are you using blast 2 sequences instead of blastn?