This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Do I have to look for sequence or reverse complement?

I have a gene reference sequence I downloaded from NCBI: https://www.ncbi.nlm.nih.gov/gene/102267223#reference-sequences I've read a paper and wanted to do a little sanity check mostly for educational purposes. Basically I want to find primers in a reference sequence. The primers are for example: 

E8-S GCTAACCTCTCTGGACCACCTTC 
E8-A TGTCAGCCTCAGGAACACCC

I could find Start primer, but couldn't find Abort primer. The command I am using to find primers is:

In [74]: yak_2.seq.find("GCTAACCTCTCTGGACCACCTTC")
Out[74]: 35708

When I tried to search for reverse_compliment() did not find anything. Am I doing something stupidly wrong?

Thanks.

sequence biopython
• 3,956 views • link
updated by william.bill.langdon • william.bill.langdon • written by eyb eyb

How did you search for reverse_complement? Just to be sure that's not where things went wrong...

• 0 views • link
written by WouterDeCoster WouterDeCoster 
In [86]: dna = Seq("GCTAACCTCTCTGGACCACCTTC")
In [87]: dna.reverse_complement
Out[87]: <bound method Seq.reverse_complement of Seq('GCTAACCTCTCTGGACCACCTTC', Alphabet())>
In [88]: dna.reverse_complement()
Out[88]: Seq('GAAGGTGGTCCAGAGAGGTTAGC', Alphabet())
In [90]: yak_2.seq.find(dna.reverse_complement())
Out[90]: -1
• 0 views • link
written by eyb eyb

Can't think of what is wrong right now. But I assume the S and A stand for sense and antisense. When I use those primers for in silico pcr on the UCSC genome browser I find a product matching the correct gene.

• 0 views • link
written by WouterDeCoster WouterDeCoster

If A is the antisense primer, I guess that means op needs to revcomp the E8-A sequence TGTCAGCCTCAGGAACACCC not the sense one. In general I would search both primers in both directions.

• 0 views • link
written by Michael Dondrup Michael Dondrup

I've searched for reverse compliment of antisense primer, but it does not find anything.

• 0 views • link
written by eyb eyb

1 answer

Many of the popular DNA sequence matching tools (eg BWA, BarraCUDA, Bowtie2) include looking for the antisense match by default. Bill

• 0 views • link
written by william.bill.langdon • william.bill.langdon

Log in to answer this question.

More posts like this