This is a test version of Biostars. For the public version, visit https://www.biostars.org.
18S gene not present in genome assembly?

I am designing PCR primers to amplify a region of the 18S rRNA gene of Penicillium expansum. As the template for primer design, I use the consensus sequence of a multiple sequence alignment of 18S sequences obtained from the SILVA database.

When I test the primers with primer-blast, it finds the expected targets from the nucleotide collection. Additionally, I primer-blasted the primers against P. expansum genomes from NCBI Datasets. However, the expected product was found in only one of the nine available genome assemblies (GCA_004302965.1).

Why does primer-blast give (false-)negative results? Do you know a reason why 18S sequence(s) might be missing in genome assemblies?

pcr primer 18s
• 1,671 views • link
updated by Dunois • Dunois • written by milesdavis • milesdavis

Looks like that assembly (GCA_004302965.1) is the newest one. Could it just be that the others were too fragmented and missing the gene or relevant portions thereof?

• 0 views • link
written by Dunois • Dunois

That might be an explanation. Indeed, GCA_004302965.1 has the highest N50 value of all available assemblies and was sequenced with PacBio. However, to my knowledge, 18S has multiple copies in many eukaryotes, so I would still be surprised if all copies were fragmented or missing in the other assemblies.

My goal is to avoid false-negatives with primer-blast due to missing targets. Are you aware of a solution to check if a gene is present in a given assembly?

• 0 views • link
written by milesdavis • milesdavis

I find this rather strange too. That reference assembly (ASM76974v1) doesn't seem to have an 18S sequence either. I searched against that with this sequence, and I got nothing:

>KJ933289.1 Penicillium expansum strain P113 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
TTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTTTGGGTCCAACCTCCCACCCGTGT
TTATTTACCTCGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCG
CCCGCCGAAGACACCCCCGAACTCTGCCTGAAGATTGTCGTCTGAGTGAAAATATAAATTATTTAAAACT
TTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTG
CAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTC
CGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCC
CGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCRCTSTGTAGGCCCG
GCCGGCGCTTGCCGWTCAACCCAAATTTTTATCCAGGTGACCTCGGATCAGTAGGRTTCCC

Maybe you could try contacting the submitters to see what's going on?

• 0 views • link
written by Dunois • Dunois

0 answers

No answers yet.

Log in to answer this question.

More posts like this