This is a test version of Biostars. For the public version, visit https://www.biostars.org.
intarprat blastn result

I get this sequence from blastn searching for similarity how can I get the name of the gene ?

gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG

blast
• 1,736 views • link
updated by Pierre Lindenbaum Pierre Lindenbaum • written by nasromer2191989 • nasromer2191989

1 answer

BLAT your sequence using the UCSC https://genome.ucsc.edu/cgi-bin/hgBlat , you'll find that the best match overlap the human gene SKA2

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

I use blastn locally use the miRNAs sequences against the est & gss database and I get this list of sequences

gb|BZ605061.1|BZ605061 WHADP35TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-22F22, genomic survey sequence GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCT gb|AQ702366.1|AQ702366 HS_5431_A1_E07_T7A RPCI-11 Human Male BAC Library Homo sapiens genomic clone Plate=1007 Col=13 Row=I, genomic survey sequence CAAGTCACTAGTGGTTCGGTTTAGTAGATGATTGTGCATTGTTTCAAANTGGTGCCNTAGTGACTACAAAGCCC gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG gb|AQ000516.1|AQ000516 CIT-HSP-2289P16.TR CIT-HSP Homo sapiens genomic clone 2289P16, genomic survey sequence CCACCACTTAAACGTGGATGTACTTGCTTTGAAACTAAAGAAGTAAGTGCTTCCATGTTTTGGTGATGG gb|AQ939510.1|AQ939510 NR1-235R Human NotI clones Homo sapiens genomic, genomic survey sequence GCGACGAGCCCCTCGCACAAACCGGACCTGAGCGTTTTGTTCGTTCGGCTCGCATGA gb|KS361709.1|KS361709 RIS29306 Control and insulated FV vector RIS library Homo sapiens genomic clone CD34_Liquid_FVSGW650cHS4_Day10_1660 similar to CD34_Liquid_FVSGW650cHS4_Day10_1660, genomic survey sequence CTGTGTGTGATGAGCTGGCAGTGTATTGTTAGCTGGTTGAATATGTGAATGGCATCGGCTAACATGCAACTGCTGTCTTATTGCATATACA so I need to know the name of the gene???? thanks

• 0 views • link
written by nasromer2191989 • nasromer2191989

Log in to answer this question.

More posts like this