This is a test version of Biostars. For the public version, visit https://www.biostars.org.
coding regions in amino acid sequence

Is there any possibility to find coding regions in amino acid sequence? Kindly anyone help me

proteins

Yes it's possible. More specifically, your entire amino acid sequence is coding. By definition.

can u send me the proof please

And also if entire amino acid seq is coding region means, in that seq we will not have 3' UTR and 5' UTR rite?

Bioinformatics is at the interesting intersection of biology/biochemistry and informatics. It's understandable that you cannot have a deep understand of both, but a limited background really is required to perform effective research and get to sound results. Please pick up a biology and biochemistry handbook before proceeding.

To clear doubts only the questions are posted here. Then why you gave the answer? Not all are genius k

Hello ashamscsoft!

We believe that this post does not fit the main topic of this site.

not related to bioinformatics.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

how u people can say it is not related to bioinformatics? This is related to bioinformatics regarding gene and protein sequences

finding cds or orf through tools, i dont think this s basic biology

The problem is your entire question is a fundamental misunderstanding of basic biology. You can't find the CDS in an amino acid sequence because the amino acid sequence is the result of translating the CDS. People have tried to point this out to you, albeit in a mocking tone. In the hope that it will close this matter once and for all, I'm just going to spell it out.

Here's an example of an amino acid sequence:

MMQESATETI

This is a cDNA:

TATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATATGAGAACTGA

This is a CDS:

ATGATGCAGGAATCTGCGACAGAGACAATATGA

If I line them up, I get:

cDNA  TATTAAGTCATGATGCAGGAATCTGCGACAGAGACAATATGAGAACTGA
CDS   ---------ATGATGCAGGAATCTGCGACAGAGACAATATGA-------
AA    ----------M--M--Q--E--S--A--T--E--T--I--*--------

The CDS is all of the amino acid sequence, translated. The UTRs only occur in the cDNA.

I'm not sure how I can make this any clearer. I do recommend you do some reading on basic biology before coming to a bioinformatics forum to ask questions, and when people try to point out your mistakes, you actually try to engage with what they're saying.

So stop, have a rethink. What data do you have? What are you trying to do with it?

OK, let's try benefit of the doubt here. Are you sure you meant to say "amino acid sequence" and not "nucleotide sequence"? Is your sequence made of just the letters ATGC, or is it made up of lots of different letters?

Thanks i got it how to see cds in amino acid sequence

0 answers

No answers yet.

Log in to answer this question.