Read fragments to trim

Question

[Emilio Marmol]

Hi everyone. So I have another doubt about processing reads for miRNA-seq.

In the parameters I've recieved from the lab doing the sequencing process, they specify this:

SR Primer:

5 ́AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTGGGA3 ́

Index Primers:

5 ́CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3 ́

Also they specify a series of short index sequences for each sample, as follows:

ID               Index Sequence 
7005           ATCACG
7006           CGATGT
7007           TTAGGC
.
.
.

I don't know what specific protocol they used to make the libraries, but I assume that what specified in Index primers is what I should trimm from my reads, being them in the NNNN fragment included between both primers to trim. But, what do the Index Sequence refer to? And what about the Sequence Reference primer (SR primer)? I don't know if I should also include them in a list of sequences to trim or not...

Any help to put some light in this?

[WouterDeCoster]

I assume you received the data demultiplexed, i.e. files just containing one sample?

[Emilio Marmol]

I just realized that the NNNN corresponds to each index sequence (barcode) used in each sample for multiplexed run. So I assume that I should associate the corresponding Index primer completed with the barcode, in order to trim it from each sample. But I don't know what to do with the SR primer though. Should I include this sequence to be trimmed too?