This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How much reads count expected in microRNA exosome quantification?

Hi, I have a small RNAseq data derived from human neural exosome. I used Trim Galore and mirDeep to map and quantify. The read count is extremely low ( from 1 to 250, average 20) is that normal? I suspect my triming was not adequate the used protocol mentioned this:

Oligonucleotide sequences: *(1)

  • 5’ adapter (desalted)– 5’ rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrArUrCr(N:25252525)r(N)r(N)r(N)
  • 3’ adapter (HPLC purification)– 5’ /5rApp/(N:25252525)(N)(N)(N)TGGAATTCTCGGGTGCCAAGG/3ddC/
  • RT primer (desalted)– 5’ GCCTTGGCACCCGAGAATTCCA
  • RP1 PCR primer (HPLC Purification)– same as Illumina RP1 PCR primer
  • Indexed PCR primers RPI1-RPI48 (HPLC Purification)– same as Illumina RPI1-RPI48 primers
  • Universal PCR primer F (desalted)– 5’ AATGATACGGCGACCACCGAG
  • Universal PCR primer R (desalted)– 5’ CAAGCAGAAGACGGCATACGA

I was only able to use trim Galore with the 3' end adaptor. I didn't use the 5' adaptor at all as the the software on galaxy didn't accept other nucleotide than AGCT.

Is that possible to have this low amount of RNA from my reads? it is almost 0%, however. the results are pointing to the same microRNA expected but in a extremely low read count Marie

microrna count exosome read

0 answers

No answers yet.

Log in to answer this question.