Hello,
I have a FASTQ file of raw paired reads of whole genome bisulfite sequencing data of cfDNA. When running fastqc on my file I see the following in overrepresented sequences:
TTGGAGGCTCATCGTTCCTAGCTTGAGTATCTCGTATGCCGTCTTCTGCT 2692 0.24563590226027004 RNA PCR Primer, Index 26 (96% over 27bp)
CGTTGGAGGCTCATCGTTCCTAGCTTGAGTATCTCGTATGCCGTCTTCTG 1996 0.18212825442477673 RNA PCR Primer, Index 26 (96% over 25bp)
GTTGGAGGCTCATCGTTCCTAGCTTGAGTATCTCGTATGCCGTCTTCTGC 1971 0.17984708891344436 RNA PCR Primer, Index 26 (96% over 26bp)
What would be the proper command to trim the RNA PCR primers?
Thank you, Carlos
1 answer
You can use fastp/bbduk.sh/cutadapt to remove any sequences you do not need.
Guide for bbduk.sh (use literal=sequence_you_want_to remove); https://jgi.doe.gov/data-and-tools/software-tools/bbtools/bb-tools-user-guide/bbduk-guide/
fastp guide: https://github.com/OpenGene/fastp#simple-usage
Log in to answer this question.
-
Is mir-seq reads quality good (Fastqc report) for DE analysis?
written by mohammadhassanj
-
What do Over-represented Sequences mean in FastQC using RNA-Seq?
written by Saran •
-
Single Cell RNA-Seq : Should I trim Poly-T & Clontech sequences called as "Overrepresented sequence…
written by gsr9999
-
Removing overrepresented primer sequences
written by Ml6237 •
-
Salmon Quantification for RNA-seq Read Pairs with Different Lengths
written by ATpoint
-
Trimming Overrepresented Sequences in paired-end RNA-Seq data, as underlined by FastQC.
written by Shaurya Jauhari •
-
Trimming adapters from miRNA-seq
written by Emilio Marmol
-
Trimming adapters of Hiseq2000 pair end reads
written by Emma •
-
trimming with cutadapt
written by mgadrianam •
