This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Tool for Converting STR Sequence Data to Bracketed Sequence

Can anyone recommend a tool (preferably open source) that converts STR sequence data to its bracketed notation? For example, with a repeat motif of TCTA, the following STR sequence

TCTATCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA

would get converted to [TCTA][TCTG]3[TCTA]12

Thank you!

str sequence next-gen

0 answers

No answers yet.

Log in to answer this question.