Annotating variants from a sequence and list of position-specific variants
Hello all,
I have a list of sequences and for every sequence there is a corresponding table that contains position-specific variants. To give you an example:
Here is a sequence:
>seq1
ATGGAGGATCAAGTTGGGTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTTGGTCACTATCTCCGTAACAAAATCGAAGGAAACACTA
And here is the corresponding variation information:
position variant_allele
11 C
12 G
18 A
Does anyone know of any straightforward tool (preferably a package in R) which can annotate these variants (whether the variant is synonymous/non-synonymous). I do not use/convert this information into a vcf file at any stage. Any help is appreciated!
• 785 views
•
link
0 answers
No answers yet.
Log in to answer this question.