Hello all,

I have a list of sequences and for every sequence there is a corresponding table that contains position-specific variants. To give you an example:

Here is a sequence:

>seq1
ATGGAGGATCAAGTTGGGTTTGGGTTCCGTCCGAACGACGAGGAGCTCGTTGGTCACTATCTCCGTAACAAAATCGAAGGAAACACTA

And here is the corresponding variation information:

position  variant_allele
11            C
12            G
18            A

Does anyone know of any straightforward tool (preferably a package in R) which can annotate these variants (whether the variant is synonymous/non-synonymous). I do not use/convert this information into a vcf file at any stage. Any help is appreciated!