More posts like this
-
How to get transcriptome reference?
written by ธาดา •I have the rna sequence from nanopore. So I want to alignment my rna sequence with transcriptome reference. But I don't know how to get …
-
NCBI nucleotide ID to protein ID
written by mxlsherry1992 •Dear all, I have some NCBI nucleotide ID, about 4,000. I want to download it's protein sequence from NCBI. I know we can download the …
-
TRANSDECODER v5.0.2 - nucleotide sequences with ambiguity characters S,R,W,K, Y
written by dtejadamartinez •Hello, I download 30 coding sequences genomes of different species from Ensembl or NCBI. In order to eliminate the transcripts and isoforms I used cd-hitest …
-
FASTA file into excel file format?
written by Azhar •Hi, I have a NCBI fast seq file like >mrna1 gctatatagactgatagctag >mrna2 acgaggctagcggattg for whole Human genome and i want to convert it into excel …
-
Genome & Protein Retrival
written by Nitha •Hi all, I tried to download genome and protein of chlamydia (different strain) and human from NCBI, but I couldn't download from NCBI ftp option, …
-
what is the difference between reference genome sequence from UCSC and ensembl ?
written by PeiHi: To map reads, (small RNA sequencing) to reference genome, I'd like to download fasta-format sequence first. As both ensembl and UCSC provide these resource, …
-
Extract All Long Non-Coding Rna For Mouse
written by ancient_learner<p>Hi all i was just trying to extract all the non-coding rna data for mouse from ucsc genome browser. from the table browser i got …
-
Document A Ucsc Table Browser Query And/Or Convert Query To An Mysql Expression
written by Duarte Molha<p>Hi guys</p> <p>I have been creating some relatively complex UCSC table browser queries and I would like to save the parameters of those queries either …
-
Major Bioinformatics Website Usage Statistics
written by Casey Bergman<p>Does anyone know of links to the web usage statistics over time of the following major bioinformatics portals?</p> <ul> <li>The UCSC Genome Browser</li> <li>Ensembl</li> <li>Galaxy</li> …
-
How To Get A List Of All The Genes On The Human Chromosome Y
written by Fred Fleche<p>A colleague of mine was asking for a list of all the genes of the human chromosome Y.</p> <p>I did it through our internal gene …
Please proof read your question and add details on why you would want to do this task - it looks like a mammoth endeavor for someone without ready access to local mirrors of the source.
I need to do some annotation for the data I have so i need all the lncrna from database related to aging
Why not BLAST against an appropriate database and then filter? Or run over the web queries for your sequences that need annotation? Why do you want to download what will definitely be redundant entries from all major databases?
I need lnrna annotated data for aging related from all the database
Please do not add answers unless you mean to answer your own question. If you wish to add a reply to someone's comment, please use the appropriate "Add Reply" option. If you wish to add more information to your question, use the "Edit" option on your question. Please read these posts: https://www.biostars.org/t/how-to/
I am moving your answer to a comment now.