More posts like this
-
RNA-Seq
written by Muhammad •Dear, I have male and female samples, I want to do a sex-biased gene analysis. My question is should I compare males with normal or …
-
Omics data collection and merging of datasets from different studies
written by BioQueen •Hi! I'm going to do omics analysis on skin basal cell carcinoma. I'm currently trying to find publicly available data to use to make a …
-
Sex chromosome filtering/Sex linked SNPs filtering
written by safiq713 •Dear All, I am new in NGS analysis. I have 90 samples ddRAD data. I am using reference based analysis. In my samples some samples …
-
meta-analysis to multiple RNA-seq differential studies
written by Shicheng GuoDear All, I want to perform a meta-analysis to several gene expression differential analysis studies with R. What I have includes log2(FoldChange), raw P-value, differential …
-
FASTA file into excel file format?
written by Azhar •Hi, I have a NCBI fast seq file like >mrna1 gctatatagactgatagctag >mrna2 acgaggctagcggattg for whole Human genome and i want to convert it into excel …
-
WGCNA lncRNA-mrna interaction
written by Azhar •I am new to R want to know that I have already normalized data for lncRNA and mrna means Excel files for different regions for …
-
Volcano plot and heat map
written by Azhar •I have lncrna and mrna microarray normalized data in excel format . I want to analyze it for mouse data by using Heat map volcano …
-
LNRNA funcational annotation
written by Azhar •I have Lnrna lists data in excel from microarray i want to do functiona annotation by DAVID or other source but problem is this the …
-
Heat graph problem
written by Azhar •I am using the micraorray data analysis, trying to make heat graph for lnRNA which has some nmeric numbers as part of refseq ID like …
-
TF and Promoter
written by Azhar •I have a novel TF binding site related to my study to important gene promoter so i want to confirm that but i don,t have …
Since there is not much information about the data in your question, separate samples based on gender and do a differential expression analysis.
I have male and female brain ln RNA and mRNA micro array data , I want to do some bioinformatics and statistical analysis what should i do ?