Please don't use the answer area to clarify questions: use the comments and link to external content if required. Also when posting FASTA format you need to indent 4 spaces for proper formatting.
Unspliced Rna And Rrna Sequences From Biomart
Hi all,
I pulled big dataset from biomart with unspliced and cDNA sequences. To my suprise pre-mRNA and mRNA were obiously correct but the rRNA and miRNA sequence were exactly the same. Does biomart only have unspliced sequences for messenger RNA and nothing more? I would think it should give an error if it doesn't have that. Thanks
Tom
• 3,886 views
•
link
1 answer
To Obi Griffith;
I have puled the entire set and the files are identical, so evey one of them is the same. The unspliced transcripts are exactly the same as cDNA for every transcript pulled. When you try the two of the following xml requests
<Dataset name = "hsapiens_gene_ensembl" interface = "default" >
<Filter name = "status" value = "KNOWN"/>
<Filter name = "transcript_status" value = "KNOWN"/>
<Filter name = "biotype" value = "miRNA"/>
<Attribute name = "ensembl_transcript_id" />
<Attribute name = "transcript_exon_intron" />
<Dataset name = "hsapiens_gene_ensembl" interface = "default" >
<Filter name = "status" value = "KNOWN"/>
<Filter name = "transcript_status" value = "KNOWN"/>
<Filter name = "biotype" value = "miRNA"/>
<Attribute name = "ensembl_transcript_id" />
<Attribute name = "cdna" />
1st sequences from online biomart;
>ENST00000384841
TGATGCTTTGCTGGCTGGTGCAGTGCCTGAGGGAGTAAGAGCCCTGTTGTTGTCAGATAG
TGTCTTACTCCCTCAGGCACATCTCCAGCGAGTCTCT
>ENST00000384841
TGATGCTTTGCTGGCTGGTGCAGTGCCTGAGGGAGTAAGAGCCCTGTTGTTGTCAGATAG
TGTCTTACTCCCTCAGGCACATCTCCAGCGAGTCTCT
Thanks.
• 3 views
•
link
• 0 views
•
link
Log in to answer this question.
It is not clear what you did and what you expect to be the result. Could you clarify what you were attempting to get from biomart and what you got that is in question?
Sorry about that. I specified that I want human miRNA and rRNA sequences. I separetly pulled cDNA and transcript_intron_exon sequences - I want both mature and pre-RNA/unscpliced sequences. What I found out that both cDNA and transcript_exon_intron sequence are the same for rRNA and miRNA. They are as they should in case of mRNA. So I was wondering is it just ensembl does not have pre-miRNA and pre-rRNA sequences or is it some kind of error. Thanks
Is it possible that the rRNA and miRNA transcript examples you looked at are not spliced? Can you give us an example of an rRNA or miRNA that is not returning the results you expect in BioMart?