This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Bowtie memory warning

I am aligning my files with bowtie 1.0.0 via our HPC.

bowtie /UCSC/hg19/Sequence/BowtieIndex/genome -p 16 --chunkmbs 16 -t -m 1 -S --max ${file1:0:9}_multimap.fastq -1 ${file1} -2 ${file2} ${file3}

With or without --chunkmbs, I still get the warning. I have tried reducing the amount of threads (-p 4) but still no luck.

Warning: Exhausted best-first chunk memory for read SRRXXXXXX.93100 HWI-ST706:161:C11YEACXX:5:1101:3338:27152 length=101/1 (patid 89557); skipping read
Warning: Exhausted best-first chunk memory for read SRRXXXXXX.93659 HWI-ST706:161:C11YEACXX:5:1101:15215:27237 length=101/1 (patid 89708); skipping read
Warning: Exhausted best-first chunk memory for read SRRXXXXXX.93679 HWI-ST706:161:C11YEACXX:5:1101:15767:27194 length=101/1 (patid 89728); skipping read
Warning: Exhausted best-first chunk memory for read SRRXXXXXX.93748 HWI-ST706:161:C11YEACXX:5:1101:17333:27035 length=101/1 (patid 89794); skipping read
bowtie
• 7,349 views • link
updated by Istvan Albert Istvan Albert • written by umn_bist • umn_bist

Can you try a higher number --chunkmbs 200 ? There are indications that this fixes the problem.

• 0 views • link
written by GenoMax GenoMax

Test sample. This is a deleted post.Test sample. This is a deleted post.

• 0 views • link
written by umn_bist • umn_bist

Hi, I have got the same problems. I try --chunkmbs 1000, -p 5, it is still warning.

• 0 views • link
written by Francis • Francis

3 answers

you can try bowtie2, this problem is fixed in it.

Few modification in following command will do

bowtie2 -p 16 -N 1 -x $Bowtie2Index -S AlignesReads.sam -1 $R1File -2 $R2File
• 0 views • link
written by Govardhan Anande Govardhan Anande

I see those warnings all the time for unmappable reads. I still get good mapped data. Are you getting any mapped reads? What percentage?

• 0 views • link
written by jotan jotan

Sometimes in the job queue I've found if my chunkmbs is fine, lower your threads around ten less than the server allocation. Generally helps me.

• 0 views • link
written by Biogeek Biogeek

@umn_bist has said in OP that lowering the # of threads to 4 did not help.

• 0 views • link
written by GenoMax GenoMax

Log in to answer this question.

More posts like this
  • Warnings in the Hisat2 alignment output files
    written by newbie newbie
    Before doing the alignment, I used fastqc on the fastq.gz files and observed adapter content. ![enter image description here][1] So, I removed the adapter content …
  • Evaluation of HISAT2 Alignment Result
    written by modarzi modarzi
    Hi, I run hisat2 for one of my sample(RNA-seq fastq) but I receive lots of Warning. You can see the result of this analysis: Warning: …
  • align_and_estimate_abundance after assembly in Trinity
    written by nasreenbano91 • nasreenbano91
    i have transcriptome data (R1 and R2 of Cestrum diurnum & R1 AND R2 of Cestrum nocternum). I have to perform de novo assembly through …
  • MuMRescueLite.py - multi-mapping reads rescue script failing
    written by newscient • newscient
    I am trying to use the script MuMRescueLite.py from http://genome.gsc.riken.jp/osc/english/dataresource/. That's the link for the software: http://genome.gsc.riken.jp/osc/english/software/src/MuMRescueLite_090522.tar.gz What it does more or less: After mapping, …
  • rsem-calculate-expression ran out of memory
    written by moxu moxu
    I first built the terence with the following command rsem-prepare-reference --bowtie reference_hg19.fa hg19_ref And then ran the following: rsem-calculate-expression --paired-end PairedEnd1.fastq PairedEnd2.fastq hg19_ref my_test_sample After …
  • ncbi sra toolkit, how to modify the fastq format? Need filter information
    written by claude.loverdo • claude.loverdo
    I want to use data from NCBI. The classic fatsq format is: @SRR2192406.1 HWI-ST0860_91:8:1101:1925:1972 length=100 GTTTGNACCATCTTGACAGACTTCAAAAATTGGCTGGGGTCTAAATTGTTCCCCAAGCTGCCCGGCCTCCCCTTCATCTCTTGTCAAGATCGGAAGAGCA +SRR2192406.1 HWI-ST0860_91:8:1101:1925:1972 length=100 CBCFF#2ACFHFHJJIJIJIJJJJJJIGIGHHIJJI??D?@FGIJJJJIIGFHGHIIIEIIIFHHFEEE2?>ABCACDDACCCAAC@>@AA8<22922?C @SRR2192406.1 HWI-ST0860_91:8:1101:1925:1972 length=100 TGACAAGAGATGAAGGGGAGGCCGGGCAGCTTGGGGAACAATTTAGACCCCAGCCAATTTTTGAAGTCTGTCAAGATGGTGCAAACAGATCGGAAGAGCG +SRR2192406.1 …
  • Minimal length of sequence for reference alignment.
    written by mieszko91 • mieszko91
    Hi! When I am using bowtie 2 to reference alignment, console displays warnings about length of my sequences: > Warning: skipping mate #2 of read …
  • cutadapt cannot work on my fastq files
    written by Jingyue • Jingyue
    Hi, I download .sra files from NCBI and convert them into fastq file by fastq-dump. So when I try to use cutadapt to trim my …
  • Htseq Count
    written by sethugunja • sethugunja
    <p>Hi guys,</p> <p>I want to use htseq-edgeR to validate my differentially expression cuffdiff results.</p> <p>For this, first htseq-count have to be used to count the …
  • Warnings In Bowtie Mapping
    written by bashwin.u • bashwin.u
    <p>Hello,</p> <p>I am trying to use bowtie on small synthetic data for short read mapping. My command is <code>./bowtie -p 8 -t -S hg19 -1 …