This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Why blast result gives Homo sapiens BAC clone

Blast results usually give Homo sapiens BAC clone.

For example, following is a sequence from EML4:

AGGTAGACTGAGGTTCTGTAAAGGATCTAGAGAAGTTTATTTGAAAATAAGAAGCATTGCAAATGGCAGTAGTGAAAAAGGTTGGAAAAGAG

Blast it in NCBI, it doesn't give EML4, but only gives:

Homo sapiens BAC clone RP11-379A23 from 2, complete sequence

blast bac clone

As @Jean-Karim pointed out below restricting the search space to "Human genomic + transcript" produces two matches which appear to be the correct result (EML4 isoform a/b).

1 answer

It depends on which database you're using but most likely your sequence is from an intron. Try using the human genomic DNA database and see where the sequence maps.

Log in to answer this question.