Why blast result gives Homo sapiens BAC clone

Question

[chen]

Blast results usually give Homo sapiens BAC clone.

For example, following is a sequence from EML4:

AGGTAGACTGAGGTTCTGTAAAGGATCTAGAGAAGTTTATTTGAAAATAAGAAGCATTGCAAATGGCAGTAGTGAAAAAGGTTGGAAAAGAG

Blast it in NCBI, it doesn't give EML4, but only gives:

Homo sapiens BAC clone RP11-379A23 from 2, complete sequence

[GenoMax]

As @Jean-Karim pointed out below restricting the search space to "Human genomic + transcript" produces two matches which appear to be the correct result (EML4 isoform a/b).

Answer 1

[Jean-Karim Heriche]

It depends on which database you're using but most likely your sequence is from an intron. Try using the human genomic DNA database and see where the sequence maps.