How to get a sequence of Clone and do alignment?
Hi. I have a problem with the job I have to do. It's about: Based on the CDS sequence, search for the clone or chromosome sequence with the highest degree of similarity and perform alignment.
I have a S100A1 gene for zebrafish with CDS (found on NCBI, I hope I do it correct):
>AB195559.1:1-141,224-373 Danio rerio S100A1 gene for S100A1 protein, complete cds
ATGGTTTCAAAACTGGAAAATGCAATGGAAGGCCTGATTAAAGTCTTCCACACATACTCCTCCAAAGAGG
GAGACAAGTACAAGCTAAGCAAATCTGAGCTTAAAAGCTTGCTTCAAGGGGAACTCAGTGACTTTTTAGC
CGCAAGTAAAGACCCCATGGTGGTGGAGAAGATCATGTCTGATCTGGATGAGAACCGGGATGGAGAGGTG
GACTTTCAGGAGTTTGTTGTGCTGGTGGCTGCTCTCACTGTGGCATGCAATGAGTTTTTTGTAGAGAGCA
TGAAGAATTAA
How do I find the clone or chromosome sequence? Blast? When I put the CDS in a blast, it gets as the most likely sequence from which I pulled this CDS. And once I get the clone sequence, will ClustalOmega be OK to do that?
Can someone explain me a pipeline?
• 1,155 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Have you conceptually understood what you need to do? It sounds like you are not 100% clear. Generally one would clone something experimentally and then have that sequence in hand when you go looking for a similar sequence in databases. In this case it sounds like you don't have a defined sequence in hand.
You are kind of on the right track and once you find the sequence of interest clustal omega would be fine to use. Think about trying to align a clone (much smaller) to a chromosome in a pairwise alignment. It is going to cause you problems unless you find a smaller region to do the alignments.
Honestly, I'm not really sure exactly what I'm supposed to do, but what I've written is the exact command from which I'm supposed to deduce how to do this task. 1. find DNA sequences of some gene. 2. pull out the CDS from it - I hope I did it correctly. 3) Based on this CDS sequence, search for a clone or chromosome sequence and perform alignment. So I tries to figure out how I should do it. And I'm stuck on point 3.
Like I said above you are on right track. You just need to identify the correct sequence to align against. Since this is an assignment question I am going to leave the rest for you to complete.