Thanks. The total RNA dataset means polyA + non-polyA? I mean if it is not polyA enriched means that dataset can be used for both mRNA and ncRNA detection?
Hi everyone,
There are tools (miRDeep2, deepBase, ... etc) for finding and predicting known and novel non-coding RNAs(ncRNA) from RNA-seq data.
The question is, should the RNA-seq library be prepared specifically for ncRNA (lncRNA, miRNA, ...etc) or every RNA-seq dataset which are used for mRNA expression analysis can be also used to find ncRNA through the tools mentioned?
Thanks in advance
2 answers
Don't polyA enrich if you want to look at ncRNAs (some will be polyadenylated, others not). Note that you can't look at miRNAs and lincRNAs at the same time, they require different library prep.
Correct, instead of polyA enrichment one does ribo-depletion. You can then detect mRNA and ncRNA.
One add here: You can detect ncRNAs with RNA-Seq and ribo-depletion, but not by using miRDeep. The tool is not programmed for such experiments. At least not the version I'm aware of.
hi Devon I have some human non coding RNA-seq data. For getting diff-exp of miRNA,I should trim length between 18 to 30 befor starting? why Avg. Sequence length is 51,can I use these data for getting diff-exp of lncRNA too?
Don't worry about trimming to a particular length. If you trim off of adapters then that will largely take care of itself. Assuming you really sequenced mostly miRNA, then the remaining sequence is adapter and junk, which will get trimmed. Of course if the average length is still 51 after trimming then most likely you have mostly non-miRNA.
Thank you for your attention. I have several problems with noncoding RNA-seq data, library of some of them is ncRNA-Seq and its other is miRNA-Seq,what is difference? Second, when I use fastqc, it shows that the adapter is trimmed, but length is 51.why?!
You'd have to ask whoever created the library for details of what they might mean by ncRNAseq vs. miRNAseq. My presumption is that miRNAseq is a standard small RNAseq kit, whereas ncRNAseq is either total RNA (i.e., Ribo-depleted) or ribo and polyA depleted, possibly with some additional size selection.
FastQC doesn't perform trimming. If it reports that everything is length 51 then you haven't done any trimming (or you used the wrong adapter).
If ncRNA-Seq library means total RNA,for getting diff-exp of miRNA should I trim length before starting small RNA-seq analysis?
is it possible fastqc give wrong report about Existence or type of adapter?
Just trim adapters, it's rarely worthwhile to trim to a specific length. FastQC will only be wrong if adapters it has never heard of are being used. The odds of that are low.
you know I compare the adapter that fastqc suggest with that Experimenter said for one experiment,they are quite different and I am extremely confused. Do you have any suggestions?
What'd the experimenter expect them to be and what did FastQC report? Perhaps you got the wrong samples (it's happened to me before).
experimenter said: ADAPTOR3=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -ADAPTOR5=GTTCAGAGTTCTACAGTCCGACGATC
FastQC report: illumina universal Adapter
This time more carefully, I see that fastQC reported "illumina universal Adapter" but I use "TruSeq Universal Adapter",are they different?
I use "TruSeq Universal Adapter" because in "illumina adapter seq pdf" and the site" https://github.com/csf-ngs/fastqc/blob/master/Contaminants/contaminant_list.txt " one universal Adapter exist that it is "TruSeq Universal Adapter"
"Adapter 5" is a sequencing primer, adapter 3 is used by a bunch of things in illumina sequencing. Don't trust what the experimenter said, he/she doesn't understand what's being asked. Just trim the reads with "Trim Galore!", which will pick up whatever the proper adapter is. Having said that, if FastQC didn't show up much then it isn't there and there's essentially no miRNA that was sequenced (regardless of what the experimenter is expecting).
Really?! Thank you for helping and awareness.
Another question, if after trimming true adapter, Avg. The sequence length is not about 22 for example be 30 or 40, something is wrong?
is it possible all of samples of one experiment need trim adapter except one or two?
Maybe you have a bunch of pre-miRNAs? Just align them and see where they go. It's possible for a couple samples to not have any adapter read through (e.g., if they have few RNAs below the read length).
No I don`t think.if it is not problem for you I will say result.
excuse me Devon,I send an E-mail to manager of fastQC and ask about "illumina universal Adapter". he said The universal adapter isn’t actually an adapter sequence as such, it’s the common sequence which exists at the start of all of the illumina adapter and primer sequences before they diverge into the different sub-variants.
in your opinion it is adapter 3 that the experimenter had told me previously؟
If I tell you the truth,I work only with windows software,It is so hard for me to learn "Trim Galore!" which is not windows software.
experimenter said: ADAPTOR3=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -ADAPTOR5=GTTCAGAGTTCTACAGTCCGACGATC
FastQC report: illumina universal Adapter
This time more carefully, I see that fastQC reported "illumina universal Adapter" but I use "TruSeq Universal Adapter",are they different?
I use "TruSeq Universal Adapter" because in "illumina adapter seq pdf" and the site" https://github.com/csf-ngs/fastqc/blob/master/Contaminants/contaminant_list.txt " one universal Adapter exist that it is "TruSeq Universal Adapter"
Log in to answer this question.
If you want to use one of the tools you mentioned, you need a small RNA-Seq library preparation. In RNA-Seq datasets you might find some short reads (between 18 and 30nt in length), but these are outliers, due to the protocol. In small RNA-Seq experiments, molecules between 18nt and 30nt (or 50nt) are selected and sequences. These short reads are needed to use e.g. miRDeep.
Note: The short length of the reads from small RNA-Seq are not because of a fragmentation! They occur in that length within the cell. In RNA-Seq you do a fragmentation step and in small RNA-Seq you don't.
Thanks. This is also informative. Means according the the protocol exist so far, they can't be detected at the same time.