Biostar Beta. Not for public use.
Question: How to get sequence using masked repeats?
0
Entering edit mode

I have a bed file like :

chr7  109259875  109259938  ENSMUST00000033300  800  +

I want to have sequence of this regions using masked repeats like :

>mm10_ct_polyaclusters_6257_ENSMUST00000033300_range=chr7:109259876-109259938_5'pad=0_3'pad=0_strand=+_repeatMasking=N
ctagcagtgagaagcaagatgagaatctgtaatagcaactgctaagggtgacaagcaaatgtg

Would you please guide me?

ADD COMMENTlink 3.9 years ago abc • 30
Entering edit mode
0

Is the bed file defining the masked repeat regions of interest and you want to get the sequence defined by that interval with the fastq header in the format shown?

ADD REPLYlink 3.9 years ago
genomax
68k
Entering edit mode
0

exactly, I want this

ADD REPLYlink 3.9 years ago
abc
• 30
2
Entering edit mode

You can do this in Galaxy

https://usegalaxy.org/

Upload your bed file (Get Data -> Upload File) using the lefthand menu. Then: Fetch Alignments/Sequences -> Extract Genomic DNA using coordinates from assembled/unassembled genomes

ADD COMMENTlink 3.9 years ago jotan ♦ 1.2k
Entering edit mode
0

Thanks a lot, it works...

ADD REPLYlink 3.9 years ago
abc
• 30

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.0