Biostar Beta. Not for public use.
How to get sequence using masked repeats?
0
Entering edit mode
4.8 years ago
abc • 30
@abc23204

I have a bed file like :

chr7  109259875  109259938  ENSMUST00000033300  800  +

I want to have sequence of this regions using masked repeats like :

>mm10_ct_polyaclusters_6257_ENSMUST00000033300_range=chr7:109259876-109259938_5'pad=0_3'pad=0_strand=+_repeatMasking=N
ctagcagtgagaagcaagatgagaatctgtaatagcaactgctaagggtgacaagcaaatgtg

Would you please guide me?

UCSC sequence • 1.2k views
ADD COMMENTlink
0
Entering edit mode

Is the bed file defining the masked repeat regions of interest and you want to get the sequence defined by that interval with the fastq header in the format shown?

ADD REPLYlink
0
Entering edit mode

exactly, I want this

ADD REPLYlink
2
Entering edit mode
4.8 years ago
jotan ♦ 1.2k
@jotan20769

You can do this in Galaxy

https://usegalaxy.org/

Upload your bed file (Get Data -> Upload File) using the lefthand menu. Then: Fetch Alignments/Sequences -> Extract Genomic DNA using coordinates from assembled/unassembled genomes

ADD COMMENTlink
0
Entering edit mode

Thanks a lot, it works...

ADD REPLYlink

Login before adding your answer.

Similar Posts
Loading Similar Posts
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.3