CIGAR string 18M2D19M
1, What is the meaning of the following CIGAR string: 18M2D19M ?
CIGAR string: 18M2D19M
chip-seq
• 1,322 views
•
link
written
by
llllllll12
0
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
I got qlen = 276 using bam_cigar2qlen in htslib but I count that cigar by myself, it should be 263.
written by Aaron 1the cigar string is as following: 1=1I4=1I7=1D5=1D4=1D2=1I9=1I13=1X7=1I13=1X1=1I11=1D3=1D1=1X2=1I10=1I2=1X1=1I11=1X3=1D9=2D2=1D26=1D5=1D6=1I17=1D3=1D4=1D3=1I1=1I1=1X3=1D10=1I10=1D2=1D10=1D22=
-
Samtools Filter by CIGAR string
written by Ruoshui 0Hi, I have a bam file and want to filter it by CIGAR string. I want to keep the lines that have a match larger …
-
Tool for extracting part of aligned sequence by CIGAR string
written by Charles-Alexandre Roy 9Is anyone aware of a tool that supports extracting a portion of an aligned read by the CIGAR string? **Inputs**: - a CIGAR string, e.g.: …
-
BWA cigar not corresponding to reality
written by ADDNOTHIING 1Hi everyone, I am mapping reads from different size and I run into an issue concerning BWA and Bowtie2. I have a reads of 93bp …
-
How to know the aligned base of a specific position from a read
written by irfanwustl 9What can be an easy way to get the aligned base of a specific position from a read in bam file? If the CIGAR string …
-
Extracting CIGAR string from a specific region of a read in a bam file using pysam?
written by kiki4133 0I am trying to use pysam to extract the CIGAR string from a bam file of aligned long-read RNA sequencing data. I want to extract …
-
How to convert from a cigar string to extended cigar string?
written by omariqbal2017 0I have a cigar string and the MD tag of the corresponding read record and I want to get the extended cigar string. Is there …
-
the theory , algorithms, file formats
written by llllllll12 01. Construct Burrow-Wheeler transform for the following sequence TTCGCT 2. ) What are the main advantages of BWT aligners compared to hash-table based?
-
Cigar String - Are Soft Clipped Reads Only Ever At The Start Or End?
written by Clare 18<p>Forgive this basic question, but with a cigar string, are soft clipped reads only ever seen at the start or end of the read and …
-
What Does This Cigar Mean?
written by Gangcai 23<p>Dear All, Following are part of the output of tophat(v1.3.0):</p> <pre><code>DBV2SVN1_64_7_2105_14622_191104_0_2 256 I 4589 3 50M * 0 0 AGTGTTAGTGTTGTTGTCTGTTGCTTGGTCAACATCATCTTGTCGTTTTT HFHFHFHFHFHHHHHFHHFHHHHHHHHHHHHHHHHHHHHHHGHHHHHHHE NM:i:0 NH:i:2 CC:Z:II CP:i:4527909 …
Hello sofiazizi12
As I said on your other question, please don't ask this forum to do your homework for you. You can easily glean this info from the samtools specification https://samtools.github.io/hts-specs/SAMv1.pdf