Hi,
I am using the great tools bam-readcount (which I really like), but I am having a problem, when I run the tool I got nothing as an output.
I successfully install the program, and I was able to use it on a set of bam file creating by bowtie2. Here is the cmd line.
$ bam-readcount -l position.tab -w 1 -f mygenome.fna myBowtie2BamFile.bam
Then, when I use Bam files coming from segemehl (http://www.bioinf.uni-leipzig.de/Software/segemehl/) I got no output at all, and also no error.
I really don't understand where the problem could come from, here is one row of the bam file.
Thanks for your help.
M00842:144:000000000-AF21A:1:2114:9089:22345 1:N:0:6 321 Chr1 12754960 255 137M * 0 0 TTTTCTCCCATGTGGTTTTCTTTACTAAGGTTTTTAATGAGGTGATGAATCATGTGTTCTAAGCTTAGACTCTTGAATAAGTCTTGCTCATGAGGTGGAGTATTGATAAAGACTCAAATAAGAAAGGCCTAGTATTG 4@3@B4@B3?334F30FGF?44FG3F4BG3BF3?FEGGFEBFB/1BGH121<@1GFHHH222@@111?G<FF1?11<<<DDD1=GGF11<11=1<0.<../<=B00<0=0=0/000:0GG:000:/..;;C/00<CB NM:i:6 MD:Z:59C15C11G1T5G11C29 NH:i:1 XI:i:0 XL:i:2 XA:Z:X XX:i:115 XY:i:251 XQ:i:1 XP:Z:Chr1 XU:i:12754980 XS:i:0
2 answers
I see two possible sources of error:
First, your read name contains a white space. Although SAM is tab-separated, some tools don't cope with such formatting.
Second, your example read has the flag for "not primary alignment". You may check your whole alignment with RSeQCs bam_stat.py (see here).
Cheers,
Michael
Do both your bams and your bed file use the same nomenclature? (i.e chr1 vs 1 vs Chr1)
Log in to answer this question.
what's the content of position.tab please
Just a regular bed file, it is a list of SNPs of interest. I am looking at the nucleotide frequencies at the given position. But once again, using the bam file coming from bowtie2 bam-readcount is working perfectly. The problem is when I use bam file coming from segemehl.
"Just a regular bed file" can you please show us a line on chr1 please
Sure, here is the input bed file I am giving to bam-readcount
Chr1 12755477 12755478 Chr1 12755536 12755537 Chr1 12755637 12755638 Chr1 12755742 12755743 Chr1 12755758 12755759
Could you print a row from the other (working) BAM file? That "22345 1:N:0:6" gap in the QNAME is unusual, and i'd like to know if its in the other bam