This is a test version of Biostars. For the public version, visit https://www.biostars.org.
GEO (NCBI) confusing data

Hi,

I'm have some problems with one data shared on GEO:

In this link: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE19414, we can find a list of 26 samples. Clicking on one of that, for example GSM503820, which links to http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM503820, and clicking on the ftp download link, in the bottom of the page, we can download a fasta file that contains in the first line a number and in the second line a read. I think that the first line is the count of the read specified in the second line. But is confusing because, on GEO, the data is normally provided in SRA or FASTQ format.

If I'm right about this fasta file, can I convert it on fastq file?

Thank you very much

fastq fasta sra
• 3,639 views • link
updated by Ram Ram • written by silas008 silas008

A part of the fasta file:

>3
ATTGCAATGAAGTCGTCGCTCT
>4
GAGGAAGGATAAAGATAAGC
>5
GAATCATAAGACTACTAATTA
>14
CATATCAATGTCATGGAAGAA
>31
ATCATCATTCTCCTTTTTCA
>36
GAGAGCAAATTGGAGTAATCAA
• 0 views • link
updated by Ram Ram • written by silas008 silas008

What is it that you want to do with the data? Fastq contains quality information in addition to just sequence, so you will not be able to convert directly.

• 0 views • link
updated by Ram Ram • written by Sean Davis Sean Davis

1 answer

Why do you need to convert to fastq, can't you use fasta?

I guess qualities were not provided as typically the quality of the first 30 bases or so is high, above 30. You may convert using mock qualities, see suggestions here and here.

• 0 views • link
updated by Ram Ram • written by h.mon h.mon

Log in to answer this question.

More posts like this
  • Unable to downlaod files from GEO
    written by Aaliya • Aaliya
    Hello everyone, I am facing difficulty downloading file from GEO: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE44951. **(GSE44951).** For this study sample, the **SRA number is not mentioned**. I always used …
  • RNA sequencing analysis
    written by bioinformatics • bioinformatics
    Hi, I'm trying to perform RNA sequencing analysis using data download from NCBI: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE184199 I'm following this workflow: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4934518/ These are the commands I've done …
  • Where is clonotypes .csv file
    written by yueli7 yueli7
    Hello, I tried to analysis following datasets: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5210599, or https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM5808300. In the VDJ_Analysis: https://github.com/ucdavis-bioinformatics-training/2020-Advanced_Single_Cell_RNA_Seq/blob/master/data_analysis/VDJ_Analysis_fixed.md It should has two files: 1. filtered_contig-annotation.csv, 2. clonotypes.csv. Where I …
  • How can I be sure that raw read counts are well processed from fastq files?
    written by Simon Ahn • Simon Ahn
    Hi. I'm new in bioinformatics and try to process fastq files for getting raw read count matrix. I downloaded fastq files from https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE63452 1. I …
  • GEO raw data download
    written by kwanghoon • kwanghoon
    Hi I'm trying to download Supplementary file(GSE109381_RAW.tar) at https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE109381 I clicked "http" link, but it will take 2 days... Is there any other way to …
  • SRA file identifiers for use with sra-toolkit
    written by ScubaChris • ScubaChris
    Greetings, I have been trying to download some Drosophila samples using the sra-toolkit. However, I am confused as to which identifier should be used each …
  • Multiplatform batch correction using combat
    written by Devyani • Devyani
    Hi, I wanted to analyze data from various micro-array platform such as agilent, rosetta/merk. Below is the link to the three platforms from which I …
  • Map from GEO samples' name to TCGA name
    written by landscape95 landscape95
    I am working on several GEO data sets, the samples are GSMxxx, can these samples be converted to TCGA format type TCGA-xx-xx. For example, data …
  • I need to know how to trimming RNAseq of GEO dataset.
    written by silas008 silas008
    I need to trimming the adapters of a GEO NCBI RNAseq. Link http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE28888 The fastqc shows that there are some Ilumina primeira and adapters. But …
  • Download Geo Tar File Automatically From Linux/Unix
    written by dfernan dfernan
    <p>Hi,</p> <p>I'd like to automatically download the tar files from the following links, does anyone knows how to do that?</p> <p><a href='http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE39977'>http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE39977</a></p> <p><a href='http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36375'>http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36375</a></p> <p>Kind …