DAAD Interview Questions

Dear Friends,

I have selected for daad scholaship and they will invite me for the interview coming days. if some one who has already faced such please share how was the interview and what type of questions they asked during the interview

off-topic

• 3,984 views • link

updated 10.6 years ago by Michael Dondrup

• written 10.6 years ago by ravihansa82

Hello ravihansa82!

We believe that this post does not fit the main topic of this site.

Not a bioinformatics question.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link

written 10.6 years ago by Michael Dondrup

0 answers

No answers yet.

More posts like this

Forum: Attended Strange interview
written 6.3 years ago by aloke205 •

EDIT: Censors added by https://www.biostars.org/u/25721/ Recently I had an online interview with [censored name] in [censored institution], a post doc student there. This was a …
Forum: Looking for Participants: Meenta NovaSeq RunShare Beta
written 7.1 years ago by Torrey Ah-Tye •

Hi Everyone, I'm from a small Boston based company called [Meenta][1], and we are launching a beta for our NovaSeq Runshare Program for a small …
Covert coordinates of a specific chromosome region from Grch38 to grch37?
written 7.3 years ago by DanielC

Dear Friends, I have a specific region on a chromosome on grch38 for which I want the corresponding coordinates in grch37. I know how to …
Forum: What would be the trend in next few years in NGS era?
written 7.7 years ago by ahmad mousavi

Dear friends, Despite the past few years we saw more and more data have been generated, and now days it is general to use genetic …
Forum: Programming interview via Skype
written 8.1 years ago by padgaus •

Hi, I have an interview on Friday for a position of Bioinformatician in the Royal Marsden Foundation Trust. Since I can't travel there, the interview …
Forum: Posting questions on Biostars without Googling or a preliminary Literature search
written 9.8 years ago by Rohit

Dear Biostars Lately, there has been a trend of people asking questions on biostars without googling, minimal literature search or even checking if it has …
store sequence in a local database
written 12.0 years ago by ravihansa82

Dear friends I have set of sequences(about 4000) in fasta formats as shown in the following ``` >ENSG00000127837;ENST00000248450;AAMP;sequence length: 431 GTGAGAACTGCCGCTCCTCAGGCCATGGGACAGGAGACGCTCACCCCTGGCCTCTGACTCCTGCTT ``` I need to …
Pattern recognition in genes
written 12.1 years ago by ravihansa82

<p>Dear friends I need advices and guidance from you. I have set of functionally related genes. i have extracted first intron of such genes. based …
Can Bioinfo Projects Grow On Large Social Networks?
written 15.1 years ago by Aleksandr Levchuk

<p>Imagine Facebook going into Bioinformatics - getting hundreds of millions of users collaborating with friends to solve real-world problems. What type of projects can grow …
Helping Biostar Grow
written 16.3 years ago by Eric Normandeau

Hi people! I've been using StackOverflow for some time and I appreciate the invaluable support this community has provided me to learn better tricks with …