This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic adapter fasta file preparation

Hi,dear all,

I have read http://www.usadellab.org/cms/uploads/supplementary/Trimmomatic/TrimmomaticManual_V0.32.pdf.

However I am still not clear how to prepare my own adapter file. My data is genome reseq, PE 2x150， Illumina Hiseq 3000.

Below is the universal adapter and the index adapter I got from the sequencing company.

5'univeral adapter AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

3'index adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

Who has the experience to make the adapter file? many many thanks in advance!

genome software-error
• 10,543 views • link
updated by Ram Ram • written by zhengyunchaosky • zhengyunchaosky

1 answer

Take a look at the default adapter sequences that are packaged with the program (https://github.com/timflutre/trimmomatic/tree/master/adapters). Chances are you are using TruSeq or Nextera adapters and don't need to do anything. Otherwise you can format your adapter sequences in the same way as the bundled ones, using a text editor such as Notepad.exe on Windows or TextEdit.app on Mac. Then place the file with the bundled adapter sequences named in a similar way (PE or SE).

• 0 views • link
written by Matt Shirley Matt Shirley

Log in to answer this question.

More posts like this