Thanks, that's really helpful. I'll edit and try again (or try with TrimGalore where you can just list the sequence).
I received some WES samples back from a commercial sequencing company, without an adapters file, so I created an adapters.fa file that looks like this:
>Novogene adapter,PE, 5'adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Novogene adapter, PE, 3' adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG
I put this into my script as ILLUMINACLIP:adapters.fa: 2:30:10.
This works but in my output file I get:
TrimmomaticPE: Started with arguments:
...
Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 51487885 Both Surviving: 50756708 (98.58%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 731177 (1.42%)
TrimmomaticPE: Completed successfully
Does this mean it only looks for one of the adapters, or does it mean it did not find any of the 5' adapter?
1 answer
I will say that the adapter naming is a bit weird, the difference between the names has odd whitespace. Note how both sequences are called the same:
Novogene
because the sequence id is defined as the word up until the first whitespace.
That might make Trimmomatic consider them a single sequence. In general sequences ought to have unique ids for example:
Novogene_adapter_1
and
Novogene_adapter_2
Log in to answer this question.