This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Trimmomatic not recognising both adapters

I received some WES samples back from a commercial sequencing company, without an adapters file, so I created an adapters.fa file that looks like this:

>Novogene adapter,PE, 5'adapter
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
>Novogene adapter, PE, 3' adapter
GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

I put this into my script as ILLUMINACLIP:adapters.fa: 2:30:10.

This works but in my output file I get:

TrimmomaticPE: Started with arguments:
...
Using Long Clipping Sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG'
ILLUMINACLIP: Using 0 prefix pairs, 1 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 51487885 Both Surviving: 50756708 (98.58%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 731177 (1.42%)
TrimmomaticPE: Completed successfully

Does this mean it only looks for one of the adapters, or does it mean it did not find any of the 5' adapter?

trimmomatic adapters

1 answer

I will say that the adapter naming is a bit weird, the difference between the names has odd whitespace. Note how both sequences are called the same:

Novogene

because the sequence id is defined as the word up until the first whitespace.

That might make Trimmomatic consider them a single sequence. In general sequences ought to have unique ids for example:

Novogene_adapter_1

and

Novogene_adapter_2

Thanks, that's really helpful. I'll edit and try again (or try with TrimGalore where you can just list the sequence).

Please accept Istvan's answer below (green check mark) to provide closure to this thread.

Log in to answer this question.