This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Check for Msp1 digestion in sequencing data

Hi,

I have sequencing data data from an experiment and I want to check whether my Msp1 digestion was successful in all lanes and samples (differences in the proportion of reads mapping to the reference suggests that there was some error between lanes).

How can I check this from my sequencing data? Am I able to just take the proportion of reads starting with a Msp1 cut site, or is there something more I should consider?

Example fragments:

  • ATAACACACCCAACTCTAAACCTCAAAACATTCCTAAATATAATAAACATTCATAACTAAACTCCTAAAATAACTATAAAAATATCACCCACAAAATACCA
  • CGGATGATGGTGTGTTGTTTTGTTATAGTTTTAGTGTTTTGAAGGATTGTTATAATGTTGTTGAGGTGA:nATTGGATTGATTTGAATAATGGTTGGGAGATG
  • AACCAACTTCCCAACCAACATTACAAATACAATACTCATTCATTTTATACCTCTAAATCAATATCAACCTAATAATAAACAATAATTTCAACCATATACCA
rrbs digestion bisulfite-sequencing msp1
• 1,979 views • link
updated by Ram Ram • written by Jautis Jautis

1 answer

You could count the number of uncleaved cut sites and then the number of cleaved fragments (will start/end with the cut site).

• 1 views • link
written by jr1214 • jr1214

Log in to answer this question.

More posts like this