This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Retrieve Sequences Flanking Ends Of A List Of Genes

I have a list of say ~100 genes and want to retrieve the 50 nucleotides that are just downstream of the ends of these genes. I do not have the chromosomal locations of these genes readily available. How do I automate the process of finding the position where the gene ends and get the sequence downstream of it?

I have no experience using bioinformatics tools and would appreciate any pointers.

For example, take the TRBV10-1 gene. I was able to locate it using BLAST and then can extend the sequence region displayed by changing the number in the link below. But I'm sure there's a better way.

http://www.ncbi.nlm.nih.gov/nucleotide/338858162?report=gbwithparts&from=563592&to=564041&RID=H9AFMH6C016

Thanks!

gene
• 4,589 views • link
updated by Treylathe • Treylathe • written by Abaldwin • Abaldwin

2 answers

The solution to this kind of problem is almost always to use BioMart. Briefly:

  1. Go to MartView
  2. Choose database Ensembl Genes 65; dataset Homo sapiens genes
  3. Click "Filters" (left menu); expand "GENE"
  4. Check "ID list limit" and choose "HGNC symbol(s)" in drop-down menu
  5. Paste gene symbols or upload file, 1 per line (e.g. TRBV10-1)
  6. Click "Attributes" (left menu); check "Sequences"; expand "SEQUENCES"
  7. Check "Flank (gene)"; check "Downstream flank"; enter "50" as value
  8. Click "Results", menu top-left

Result for TRBV10-1:

>ENSG00000211717|ENST00000390364
CACAGTGCTGCACAGCTGCCTCCTCTCTGCACATAAAGGGCAGTTAGAAT

Repeat, refine and download as required.

Note that there are several options for "flank"; select the one most appropriate for you. Note also that you can search using other identifiers; I assumed from your example that HGNC symbols work best for you.

• 0 views • link
written by Neilfws Neilfws

Thanks! You saved me a lot of work!

• 0 views • link
written by Abaldwin • Abaldwin

If some of the genes in the list fail to be found (for unknown reasons), is it possible to know which ones failed? The results seem to be simply a list of sequences, shorter than the list of queries, with no reference to the corresponding query. I would like to match each result to the query. Thanks again.

• 0 views • link
written by Abaldwin • Abaldwin

There's an option "Header" at step 7 which should allow you to include the HGNC symbol as part of the fasta sequence header. Another option would be to use different attributes (not sequences) which should return a table with blank entries for queries that did not retrieve data.

• 0 views • link
written by Neilfws Neilfws

You can also do this in the ucsc table browser and also galaxy, we have a quick on how to do this in galaxy here: http://blog.openhelix.eu/?p=9808F

• 0 views • link
written by Treylathe • Treylathe

Log in to answer this question.

More posts like this
  • Why do NCBI rRNA sequences have thymine?
    written by lance.leung • lance.leung
    I am slightly confused here, why are there thymine bases in the NCBI rRNA base sequence? This link shows an example of it. https://www.ncbi.nlm.nih.gov/nucleotide/NR_026332.1?report=genbank&log$=nuclalign&blast_rank=1&RID=E92WF98W014 Would …
  • Linking NCBI gene ID's to nucleotide sequence
    written by jared.j.tromp • jared.j.tromp
    I've been trying to get the nucleotide sequence for a list of genes on the command line, for example for the gene [LOC100136426][1] I would …
  • Autosomal SNPs tagging sex chromosomes?
    written by Purpleone Purpleone
    Hi, I've got some human GWAS data and looking at rs7329280 (chr13), which seems to be highly associated with the sex. This doesn't make much …
  • How Can I Find Utr Regions Of This Gene?
    written by biostar • biostar
    <p>Hi everyone, I have this <a href='http://www.ncbi.nlm.nih.gov/nucleotide/91086788?report=genbank&amp;log$=nuclalign&amp;blast_rank=1&amp;RID=HVXND5RB014'>gene</a> (Accession: XM_968180.1) from NCBI and I need its 5' UTR and 3' UTR regions. Could any of you …
  • How To Properly Limit Result From Eutils To Get Tinyseq Xml Output
    written by user56 user56
    <p>I have a gene of interest. Eg., TPMP It is this one: <a href='http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;cmd=Retrieve&amp;dopt=Graphics&amp;list_uids=7172'>http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&amp;cmd=Retrieve&amp;dopt=Graphics&amp;list_uids=7172</a></p> <p>In XML I can get the same info via this link: …
  • Extract Human Gene Sequences Based On Kegg Gene Name
    written by Dejian Dejian
    <p>Hi, I have a list of human gene names from KEGG database, for example, ALDOA, BHLHB3, PKM2, P4HA1, EPO. I can get a list of …
  • Looking Up Structural Variants Of Genes
    written by Abaldwin • Abaldwin
    <p>I am trying to find known variants of a set of genes. For example, take TRBV10-3. The link below lists four known alleles, whose sequences …
  • Protein Coding Sequence In Bioperl
    written by Gleb • Gleb
    <p>Hello!</p> <p>I'm very uncomfortable, but could you help me again. Let's see at this link <a href="http://www.ncbi.nlm.nih.gov/protein">http://www.ncbi.nlm.nih.gov/protein</a> In menu Search (bee) AND "Apis mellifera"[porgn:__txid7460]. And …
  • Protein Coding Sequence
    written by Gleb • Gleb
    <p>Hello!!</p> <p>I'm very uncomfortable, but could you help me. Let's see at this link <a href="http://www.ncbi.nlm.nih.gov/protein">http://www.ncbi.nlm.nih.gov/protein</a> In menu Search (bee) AND "Apis mellifera"[porgn:__txid7460]. And choose …
  • Is It Possible To Find For A Given Gene The Coding Sequences On Ensembl?
    written by Blunders • Blunders
    <p>This information has been found on NCBI, but attempting to find it on Ensembl.</p> <p>On NCBI, is was found by:</p> <ul> <li>Going to this <a …