Hi,
I've got some human GWAS data and looking at rs7329280 (chr13), which seems to be highly associated with the sex. This doesn't make much sense to me, it's an autosomal SNPs and on UCSC browser there's not much annotated in that region (besides the gene itself, TPTE2).
Is it likely that this SNP is either (1) in long range LD with the sex chromosomes or (2) that the probe sequence has some non-unique binding so it's capturing some sex chromosome region?
I've used blastn to check the sequence (TTCCTTGGACCTCCTAGTCAGGTCACGTAATGACGTTTCTCTGGGAATAA) against human references, the top hits seem to indicate the second option, is that right:
Select seq Homo sapiens chromosome 99.6 470 100% 3e-19 100% NC_018924.2
ref|NC_018924.2| 13, alternate assembly
CHM1_1.1
Select seq Homo sapiens chromosome 99.6 470 100% 3e-19 100% AC_000145.1
ref|AC_000145.1| 13, alternate assembly HuRef
Select seq Homo sapiens chromosome 99.6 531 100% 3e-19 100% NC_000013.11
ref|NC_000013.11| 13, GRCh38 Primary Assembly
Select seq Homo sapiens chromosome 83.8 253 100% 2e-14 96% NC_000024.10
ref|NC_000024.10| Y, GRCh38 Primary Assembly
Links in table:
- Homo sapiens chromosome 13, alternate assembly CHM1_1.1
- Homo sapiens chromosome 13, alternate assembly HuRef
- Homo sapiens chromosome 13, GRCh38 Primary Assembly
- Homo sapiens chromosome Y, GRCh38 Primary Assembly
- NC_018924.2
- AC_000145.1
- NC_000013.11
- NC_000024.10
How do people filter these SNPs out, are there lists of known "culprits" somewhere?
0 answers
No answers yet.
Log in to answer this question.