Biostar Beta. Not for public use.
Tool: RNA-Seq paired-end sequencing tophat outputted SAM file: single line or double lines?
0
Entering edit mode

Hi I've been playing around a set of RNA-Seq data for several days and the short-term goal is to infer intron retention from this RNA-Seq data. But what confused me during the past few days is that the bam file (or sam file) outputted from tophat mapping contain only one line per paired-end mapping. The basic format is as follows:

GWZHISEQ01:207:C2337ACXX:3:1102:14008:23774 385 chr1 10001 0 101M chrX

155260214       0       TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC

CTAACCCTAACCCTAACCCTAACCCTAACCCTAACC CCCFFFFFHHHHHJJJJJJJJJIIJJJJJJJJJJJJJJJJIIJJJIIJJJHIGG

GGIFCGHEHFFFFFFEBDC?CABBB?CD<<ACD<?BD?CDDD@ACBB AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:

i:0 MD:Z:101 YT:Z:UU NH:i:20 CC:Z:chr5 CP:i:10085 XS:A:+ HI:i:0

So basically my understanding is that this read is a combo between two ends, one mapped to chr1 and the other mapped to chrX. You might wonder why they mapped to different chromosomes. That's just a side issue of setting the parameter r in tophat. Let's not worry about it for now.

To my surprise (or because of my lack of knowledge), this data only contain this single line for this read instead of double lines for a pair of reads. I discussed with my friend and he told me this was the standard tophat output. Now I'm confused because I need to use HTSeq in python to get the coverage of each intron from this dataset. However, HTSeq doesn't recognize this sort of paired-end format and it only recognize paired-end sam format if each pair of reads have double lines in the same file with the same read name. Is there any way to get around this issue? Or am I missing some important points here? I did a lot of google searches but I didn't find any useful answer to this specific question. Maybe it's just me not getting the point?

Thanks in advance!

0
Entering edit mode

That alignment shows just one read. For paired-end reads, the alignment information for the mate is partly included, but the mate none-the-less has its own entry. If the mate's alignment isn't there then either you filtered the file or found a bug in tophat2 (or just haven't looked hard enough).

HTSeq will be fine with tophat's output unless you changed it.

ADD COMMENTlink 4.4 years ago Devon Ryan 90k
Entering edit mode
0

I looked at the tophat command my collaborator used to generate the data and there's nothing weird about it... I also sorted all the bam by read name but found nothing in pair except multiple alignment cases... I'm really confused here

ADD REPLYlink 4.4 years ago
lliu.hsph
• 0

Login before adding your answer.

Similar Posts
Loading Similar Posts
Powered by the version 2.0