Finding coding and UTR regions for a gene list
Hi all,
I have already found some simple sequence repeat (SSR) using MISA, SSRlocator tools on some gene sequence of human. Now I want to find the location of these SSRs, where the repeat located on the coding or non-coding (UTR) region of gene sequences, I can do it using USCS genome browser for one gene at the time, but it's time-consuming for many genes. Could you please let me know how I can perform it for many genes? Thanks
1 answer
UCSC has already computed the simple repeats.
$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg38 -e 'select K.chrom,R.repClass,R.genoStart,R.genoEnd,K.name,K.txStart,K.cdsStart,K.cdsEnd,K.txEnd from rmsk as R, knownGene as K where K.chrom=R.genoName and ((R.genoStart>=K.txStart AND R.genoEnd<=K.cdsStart) OR (R.genoStart>=K.cdsEnd AND R.genoEnd<=K.txEnd)) limit 10'
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+
| chrom | repClass | genoStart | genoEnd | name | txStart | cdsStart | cdsEnd | txEnd |
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+
| chr1 | Simple_repeat | 29744 | 29792 | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | LINE | 29901 | 30198 | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | DNA | 30342 | 30532 | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | LTR | 30693 | 30848 | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | Simple_repeat | 30854 | 30952 | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | DNA | 30342 | 30532 | uc057atz.1 | 30266 | 30266 | 30266 | 31109 |
| chr1 | LTR | 30693 | 30848 | uc057atz.1 | 30266 | 30266 | 30266 | 31109 |
| chr1 | Simple_repeat | 30854 | 30952 | uc057atz.1 | 30266 | 30266 | 30266 | 31109 |
| chr1 | LTR | 34564 | 34921 | uc001aak.4 | 34553 | 34553 | 34553 | 36081 |
| chr1 | SINE | 35216 | 35366 | uc001aak.4 | 34553 | 34553 | 34553 | 36081 |
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+
or
$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg38 -e 'select K.chrom,R.name,R.chromStart,R.chromEnd,R.sequence,K.name,K.txStart,K.cdsStart,K.cdsEnd,K.txEnd from simpleRepeat as R, knownGene as K where K.chrom=R.chrom and ((R.chromStart>=K.txStart AND R.chromEnd<=K.cdsStart) OR (R.chromStart>=K.cdsEnd AND R.chromEnd<=K.txEnd)) limit 10'
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+
| chrom | name | chromStart | chromEnd | sequence | name | txStart | cdsStart | cdsEnd | txEnd |
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+
| chr1 | trf | 30862 | 30959 | TC | uc057aty.1 | 29553 | 29553 | 29553 | 31097 |
| chr1 | trf | 30862 | 30959 | TC | uc057atz.1 | 30266 | 30266 | 30266 | 31109 |
| chr1 | trf | 90047 | 90430 | AACCTGCTGCTTCCTGGAGGAAGACAGTCCCTCAGTCCCTCTGTCTCTGCCAACCAGTT | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 92209 | 92243 | TCTGCATTGGTTTGG | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 98999 | 99042 | TTTA | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 99046 | 99116 | TTTTTTTTCTTTCTTTTTTTTTTTTTTTT | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 99046 | 99116 | T | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 99046 | 99115 | TTTTTTTTCTTTTCTTTCTTTTCTTCTT | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 99047 | 99115 | TTTTTTTTTTC | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
| chr1 | trf | 102109 | 102152 | AATAAATAAGAAAACAGAAACT | uc057aub.1 | 89294 | 89294 | 89294 | 120932 |
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+
• 0 views
•
link
updated
by
Ram
•
written
by
Pierre Lindenbaum
•
written
by
Pierre Lindenbaum
Log in to answer this question.
More posts like this
-
Getting Ensembl gene ID via biomart
written by seta
-
How many of the SSR contained transcripts have ORF?
written by Farbod
-
Location of motif
written by coolmsandhu •
-
SSR marker discovery from RNA-seq data when a reference genome is available
written by seta
-
Finding coding and UTR regions for a gene list
written by seta
-
Is there any tool to convert blastx format from tabular to xml for feeding it to blast2go?
written by seta
-
Finding simple sequence repeat (SSR) on differentially expressed RNA-seq reads
written by seta
-
Different Repeat Motif
written by Nur •
-
Is There Any Script To Count Repeats In Protein Sequences?
written by Mohammad Reza Bakhtiarizadeh
-
Finding Minisatellite Repeat Motives In Dna
written by Eric Normandeau
what kind of simple sequence repeats ? do you want to process the sequences by yourself or do you want to know if any database knows about any repeat (poly-X, repeat-masker ? )
Actually, I have some simple sequence repeat (SSR) that would like to find their location on the gene sequences of interest, if repeats located on the coding or non-coding (UTR) regions?
how do you check manually of the UTR contains a SSR ?
I have already find some SSR repeat using SSRlocator, MISA tools. Now, I want to know where is located these SSRs, on the coding or UTR parts of gene sequences of interest?