Finding coding and UTR regions for a gene list

Question

[seta]

Hi all,

I have already found some simple sequence repeat (SSR) using MISA, SSRlocator tools on some gene sequence of human. Now I want to find the location of these SSRs, where the repeat located on the coding or non-coding (UTR) region of gene sequences, I can do it using USCS genome browser for one gene at the time, but it's time-consuming for many genes. Could you please let me know how I can perform it for many genes? Thanks

[Pierre Lindenbaum]

what kind of simple sequence repeats ? do you want to process the sequences by yourself or do you want to know if any database knows about any repeat (poly-X, repeat-masker ? )

[seta]

Actually, I have some simple sequence repeat (SSR) that would like to find their location on the gene sequences of interest, if repeats located on the coding or non-coding (UTR) regions?

[Pierre Lindenbaum]

how do you check manually of the UTR contains a SSR ?

[seta]

I have already find some SSR repeat using SSRlocator, MISA tools. Now, I want to know where is located these SSRs, on the coding or UTR parts of gene sequences of interest?

Answer 1

[Pierre Lindenbaum]

UCSC has already computed the simple repeats.

$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg38 -e 'select K.chrom,R.repClass,R.genoStart,R.genoEnd,K.name,K.txStart,K.cdsStart,K.cdsEnd,K.txEnd from rmsk as R, knownGene as K where K.chrom=R.genoName and ((R.genoStart>=K.txStart AND R.genoEnd<=K.cdsStart) OR (R.genoStart>=K.cdsEnd AND R.genoEnd<=K.txEnd)) limit 10'
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+
| chrom | repClass      | genoStart | genoEnd | name       | txStart | cdsStart | cdsEnd | txEnd |
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+
| chr1  | Simple_repeat |     29744 |   29792 | uc057aty.1 |   29553 |    29553 |  29553 | 31097 |
| chr1  | LINE          |     29901 |   30198 | uc057aty.1 |   29553 |    29553 |  29553 | 31097 |
| chr1  | DNA           |     30342 |   30532 | uc057aty.1 |   29553 |    29553 |  29553 | 31097 |
| chr1  | LTR           |     30693 |   30848 | uc057aty.1 |   29553 |    29553 |  29553 | 31097 |
| chr1  | Simple_repeat |     30854 |   30952 | uc057aty.1 |   29553 |    29553 |  29553 | 31097 |
| chr1  | DNA           |     30342 |   30532 | uc057atz.1 |   30266 |    30266 |  30266 | 31109 |
| chr1  | LTR           |     30693 |   30848 | uc057atz.1 |   30266 |    30266 |  30266 | 31109 |
| chr1  | Simple_repeat |     30854 |   30952 | uc057atz.1 |   30266 |    30266 |  30266 | 31109 |
| chr1  | LTR           |     34564 |   34921 | uc001aak.4 |   34553 |    34553 |  34553 | 36081 |
| chr1  | SINE          |     35216 |   35366 | uc001aak.4 |   34553 |    34553 |  34553 | 36081 |
+-------+---------------+-----------+---------+------------+---------+----------+--------+-------+

or

$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg38 -e 'select K.chrom,R.name,R.chromStart,R.chromEnd,R.sequence,K.name,K.txStart,K.cdsStart,K.cdsEnd,K.txEnd from simpleRepeat as R, knownGene as K where K.chrom=R.chrom and ((R.chromStart>=K.txStart AND R.chromEnd<=K.cdsStart) OR (R.chromStart>=K.cdsEnd AND R.chromEnd<=K.txEnd)) limit 10'
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+
| chrom | name | chromStart | chromEnd | sequence                                                    | name       | txStart | cdsStart | cdsEnd | txEnd  |
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+
| chr1  | trf  |      30862 |    30959 | TC                                                          | uc057aty.1 |   29553 |    29553 |  29553 |  31097 |
| chr1  | trf  |      30862 |    30959 | TC                                                          | uc057atz.1 |   30266 |    30266 |  30266 |  31109 |
| chr1  | trf  |      90047 |    90430 | AACCTGCTGCTTCCTGGAGGAAGACAGTCCCTCAGTCCCTCTGTCTCTGCCAACCAGTT | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      92209 |    92243 | TCTGCATTGGTTTGG                                             | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      98999 |    99042 | TTTA                                                        | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      99046 |    99116 | TTTTTTTTCTTTCTTTTTTTTTTTTTTTT                               | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      99046 |    99116 | T                                                           | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      99046 |    99115 | TTTTTTTTCTTTTCTTTCTTTTCTTCTT                                | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |      99047 |    99115 | TTTTTTTTTTC                                                 | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
| chr1  | trf  |     102109 |   102152 | AATAAATAAGAAAACAGAAACT                                      | uc057aub.1 |   89294 |    89294 |  89294 | 120932 |
+-------+------+------------+----------+-------------------------------------------------------------+------------+---------+----------+--------+--------+

[seta]

Thanks for your nice reply, however I have some predetermined SSR repeats, like AT, CCG, etc. Could you please let me know how I can find just repeats of interest?