integrated high throughout sequencing data sets in galaxy
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
p value of significance for overlapping peaks
written by qudrat.nii •Hi all, I have MACS2 peaks for two different transcription factors and I want to find the p-value for the significance peak overlapped between these …
-
Integration of scatac-seq data with another integrated scRNA and scATAC data set
written by bioyas •Hi all, I am working on a 3 single cell data sets as follows: 1. scRNA-seq 2. scATAC-seq 3. scATAC-seq form multiomics I have already …
-
Finding regulatory elements for coexpressed genes
written by hubsnets •Hello. I have found coexpressed genes or modules. I wanted to find out the Transcription factors that regulate genes of the same module. Do you …
-
Error message during ChIP-Seq data analysis using Galaxy platform
written by sham7jdeed •Please I have a question regarding ChIP-Seq data analysis using Galaxy platform! During the trimming step (using Trim Galore) of ChIP-Seq data, I got this …
-
Target genes of position-specific transcription factors
written by zaibunnisa.t •I have a list of transcription factors with the following information: chrom position rs_ids cosmic_id motif_id motif_alt_id matched_sequence chr3 71435739 rs201008547 COSN16951339 MA0528.1 ZNF263 GAGGGAGGAAGGGACGGAGGG …
-
how to analyse gene expression using RNA-seq data
written by ashishI want know how do we calculate gene expression using RNA-seq data available on NCBI. For example I want analyze gene expression of a family …
-
changing a gold standard to a true network
written by zizigoluI have a gold standard in Arabidopsis thaliana( genes and transcription factors) like below ``` TFLocus TargetLocus InteractionType AT5G10140 AT1G65480 -1 AT5G11260 AT1G27480 -1 AT5G11260 …
-
output of a network analysis
written by zizigolu<p>dears all,</p> <p>i did a network analysis and the output nodes are probsets IDs, how i can find that each prob is related to which …
-
what's the publicly available TF binding ChIP-seq dataset with the highest coverage that you know o…
written by ewd •<p>I plan to do a computational study that need a very deeply sequenced ChIP-seq dataset (idealy for transcription factors). It would be very helpful if …
-
How to correlate genes to transcription factors in RNA-Seq data?
written by R.BluesHello everyone, I have a set of differentially expressed genes in an "A" tissue when compared with other tissues, most of these genes being typical …
why don't you start from their help page?
Or have a look at the Galaxy mooc.