Hi all, I'm analysing a few Haloplex exomes and after our standard GATK pipeline (not removing duplicates, due to haloplex exomes) I have a number of variants and frameshifts that I cannot find back in the bam files using IGV.

variant:

chr17    65850799    A/+TGAGACCGCACCAGCGACAC    .    BPTF    frameshift

FORMAT    GT:AD:DP:GQ:PL  (GT = genotype, AD = Depth per allele, DP = Coverage, GQ = Genotype quality, PL = likelihood)
Sample12    0/1:26,8:34:99:174,0,4829
Sample13    0/1:21,61:82:99:1855,0,4174

Then I extract the region from the bam file because of the size:

samtools view -h -b Sample12_sorted_realign_recal.bam' chr17:65850000-65851799 > BPTF1_Sample12.bam

And when I visualize in IGV I don't see any frameshift at all?

Does anyone has an idea what is going wrong? and where it is going wrong?