This is a test version of Biostars. For the public version, visit https://www.biostars.org.
BLAST options error: tried to set option (130) and value (1), line (537)

I'm running local blast/2.2.30+ (on a server), command blastx (-task blastx-fast) against the nr database, with a query file of about 2000 fasta nt sequences of the form:

>12345678:1200-1400_+
ACGTACGTACGTAGCTAGCTAGCTGACTGACTG

where the first number refers to genome gi, followed by start, stop, and strand

The command I'm running is:

blastx –task blastx-fast -query filein.fa -db /../../../fdb/blastdb/nr -out fileout.fa -outfmt 11 -num_threads 24 -max_target_seqs 1 –max_hsps 1 -matrix BLOSUM62 -qcov_hsp_perc 95 –strand both

If I awk line 537 from my input file (as the error refers to a line 537) I get the following - nothing unusual (lines 536 and 538 are nucleotides like this):

$ awk '{ if (NR==537) print $0 }' file.fa
CCCTGAATTAGCAGTTAAACCATTCTTCCAATTAGCATATGACATTAATACACACCGTGGTTACTTCCGAATTTCACGTG
fasta blast

2 answers

It is not an hyphen in –task and this is messing the the parsing of the command-line. This is a common error, it happened to me when copying examples from the internet (the unicode encoding is messed somehow, and what you copy is not what you see), and if you look around here you will find several posts where the problem was ultimately the same, e.g. here and here.

I believe the "line 537" refers to BLAST sources, not your input file.

Unfortunately this doesn't solve it. Usually you get a 'didn't recognise flag' type error when you copy the wrong hyphen in also.

Did you correct the other instances (–max_hsps and –strand)?

Yes, when I copy something in I correct them all as a matter of course.

It seems to be related with output format 11. Output format 6 for instance does at least begin running (although later fails with 'Segmentation fault'?). Thanks

You may try a binary search on your input file, splitting it in halves until you find the offending sequence.

Hi, was this ever solved? I'm getting same error on a protein search:

blastp -remote -query 1.faa -db nr -out out.blast -outfmt '6 qseqid sseqid pident length slen qstart qend sstart send evalue bitscore stitle' -evalue 1e-10 -max_hsps 1
BLAST options error: err:tried to set option (130) and value (1), line (537).

I think this is actually because it was pointing to an incorrect database.

Log in to answer this question.