Hi guys. I'm just getting started with bioinformatics and this is my first post on Biostars. Thanks in advance for all your help.

I've been trying to successfully acquire sample reads and align them for quite some time now, but things still seem to be going wrong. I'm using NCBI's Sequence Read Archive (SRA) to find sample data. I've been downloading and formatting that data using their SRA Toolkit, with tools like prefetch and fastq-dump. Then I've tried to align them using bowtie2.

I'll list the exact commands I've used:

prefetch SRR390728
sra-stat -x --quick SRR390728

This is what the statistics look like:

<Run accession="SRR390728" spot_count="7178576" base_count="516857472" base_count_bio="516857472" cmp_base_count="49610016">
  <Size value="193606607" units="bytes"/>
  <AlignInfo>
    <Ref seqId="GPC_000000394.1" name="5" .../>
    <Ref seqId="GPC_000000395.1" name="Y" .../>
    <Ref seqId="NC_000001.9" name="1" .../>
    <Ref seqId="NC_000002.10" name="2" .../>
    ...
    <Ref seqId="NC_000022.9" name="22" .../>
    <Ref seqId="NC_000023.9" name="X" .../>
    <Ref seqId="NC_001807.4" name="M" .../>
  </AlignInfo>
  <QualityCount>
    <Quality value="4" count="1285575"/>
    <Quality value="5" count="6274952"/>
    ...
    <Quality value="30" count="1110"/>
    <Quality value="33" count="4722"/>
  </QualityCount>
  <Databases>
    <Database>
      <Table name="PRIMARY_ALIGNMENT">
        <Statistics source="meta">
          <Rows count="12979096"/>
          <Elements count="467247456"/>
        </Statistics>
      </Table>
      <Table name="REFERENCE">
        <Statistics source="meta">
          <Rows count="616097"/>
          <Elements count="3080436051"/>
        </Statistics>
      </Table>
      <Table name="SEQUENCE">
        <Statistics source="meta">
          <Rows count="7178576"/>
          <Elements count="516857472"/>
        </Statistics>
      </Table>
    </Database>
  </Databases>
</Run>

To me this means there is alignment data in there, particularly in table: PRIMARY_ALIGNMENT. I guess raw sequencing data is also in the SEQUENCE table. fastq-dump documentation states that the SEQUENCE table is used by default, so the --table option is omitted from the first call.

fastq-dump -O ../output SRR390728
fastq-dump --table PRIMARY_ALIGNMENT -O ../output --fasta SRR390728

This leaves us with a couple of files in the output directory:

• SRR390728.fastq - a fastq file containing the raw reads from the SRA file; and
• SRR390728.fasta - a fasta file containing reads from the SRA file's PRIMARY_ALIGNMENT table.

Next, I move onto using bowtie2 - first by indexing the aligned reads so we can use it as a reference:

bowtie2-build output/SRR390728.fasta output/bowtie/SRR390728

This outputs a whole bunch of files into the output/bowtie directory. Finally, I can try to align the raw reads:

bowtie2 -x output/bowtie/SRR390728 -U output/SRR390728.fastq -S output/SRR390728.sam

30 minutes later, I've got the following depressing output:

7178576 reads; of these:
  7178576 (100.00%) were unpaired; of these:
    7178576 (100.00%) aligned 0 times
    0 (0.00%) aligned exactly 1 time
    0 (0.00%) aligned >1 times
0.00% overall alignment rate

The output sam file looks like this (without the starting line numbers):

       1 @HD VN:1.0  SO:unsorted
       2 @SQ SN:SRR390728.1  LN:36
       3 @SQ SN:SRR390728.2  LN:36
       4 @SQ SN:SRR390728.3  LN:36
..
..
..
12979095 @SQ SN:SRR390728.12979094   LN:36
12979096 @SQ SN:SRR390728.12979095   LN:36
12979097 @SQ SN:SRR390728.12979096   LN:36
12979098 @PG ID:bowtie2  PN:bowtie2  VN:2.2.5    CL:".../bowtie2-2.2.5/bowtie2-align-s --wrapper basic-0 -x output/bowtie/SRR390728 -S output/SRR390728.sam -U output/SRR39         0728.fastq"
12979099 SRR390728.1 4   *   0   0   *   *   0   0   CATTCTTCACGTAGTTCTCGAGCCTTGGTTTTCAGCGATGGAGAATGACTTTGACAAGCTGAGAGAAGNTNC    ;;;;;;;;;;;;;;;;;;;;;;;;;;;9;;665142;;;;;;;;;;;;;;;;;;;;;;;;;;;;;96&&&&(             YT:Z:UU
12979100 SRR390728.2 4   *   0   0   *   *   0   0   AAGTAGGTCTCGTCTGTGTTTTCTACGAGCTTGTGTTCCAGCTGACCCACTCCCTGGGTGGGGGGACTGGGT    ;;;;;;;;;;;;;;;;;4;;;;3;393.1+4&&5&&;;;;;;;;;;;;;;;;;;;;;<9;<;;;;;464262             YT:Z:UU
12979101 SRR390728.3 4   *   0   0   *   *   0   0   CCAGCCTGGCCAACAGAGTGTTACCCCGTTTTTACTTATTTATTATTATTATTTTGAGACAGAGCATTGGTC    -;;;8;;;;;;;,*;;';-4,44;,:&,1,4'./&1;;;;;;;669;;99;;;;;-;3;2;0;+;7442&2/   
..
..
..
20157672 SRR390728.7178574   4   *   0   0   *   *   0   0   AGAAAAAGGATGAATNNNNNNNNNNNNNNNANNNNNNNNNNNATNNCTTCNNNNGTNNANNNNNNNNNNNNT    ;;;;;;-;;;;;;*)%%%%%%%%%%%%%%%6%%%%%&&&&&&;4&&;;;;&&&&.;&&;&&&&&&&&         &&&&3    YT:Z:UU YF:Z:NS
20157673 SRR390728.7178575   4   *   0   0   *   *   0   0   AGTTTTAATTTTTNATATTTTACTTCATAGTCTTTTACACATTTTAAAATGACCTAAATTAACGACATATCA    ;;;;;;;8;;;;;%;&3;;,;&+;;1:)8+504&5/0776;;;16/10&1/.1;4.;;**4;0&7&&         6&*-&    YT:Z:UU
20157674 SRR390728.7178576   4   *   0   0   *   *   0   0   AATATCACAGCGANCGCTATAGATCGGAAGATCGGTATAGCGGTCGCTGTGATATTAGATCGGAAGAGCGTC    ;;;;;;1;;;;;1%;;;75;55:;:::%5720+,2/;;;;;;;;;;;;<;:4;;;;;:9;;;:;;,4         42&42    YT:Z:UU

Note that some of the pasted text (particularly surrounding the read qualities) might look messed up thanks to the online editor.

It seems that all of those reads have 4 as the value for their flag. The bowtie2 manual describes 4 as: "The read has no reported alignments".

Why not? What am I missing? Why was nothing aligned?