Hi! I have mapped my RNA-seq reads on reference genome by bowtie2 after trimming Illumina adapters by Trimmoatic as below,
/bowtie2$ bowtie2 -p 4 -x Dicty_primary_genomic -U trialoutput.fq -S trialoutput.sam
6619872 reads; of these:
6619872 (100.00%) were unpaired; of these:
303213 (4.58%) aligned 0 times
2426695 (36.66%) aligned exactly 1 time
3889964 (58.76%) aligned >1 times
95.42% overall alignment rate
The header of my SAM file (I have sorted SAM) looks so;
/samtools-1.9$ head trialoutput.sorted.sam
@HD VN:1.0 SO:coordinate
@SQ SN:DDB0216524|DDB_G0267364 LN:2441
@SQ SN:DDB0216528|DDB_G0267372 LN:2644
@SQ SN:DDB0191165|DDB_G0267380 LN:3559
@SQ SN:DDB0216498|DDB_G0267304 LN:4580
@SQ SN:DDB0202373|DDB_G0267338 LN:2486
@SQ SN:DDB0216520|DDB_G0267356 LN:6002
@SQ SN:DDB0307434|DDB_G0269812 LN:2651
@SQ SN:DDB0266571|DDB_G0269818 LN:2362
@SQ SN:DDB0302581|DDB_G0267990 LN:2561
As you are considering, pretty different with bowtie2 tutorial on example data as below;
@HD VN:1.0 SO:unsorted
@SQ SN:gi|9626243|ref|NC_001416.1| LN:48502
@PG ID:bowtie2 PN:bowtie2 VN:2.0.1
r1 0 gi|9626243|ref|NC_001416.1| 18401 42 122M * 0 0 TGAATGCGAACTCCGGGACGCTCAGTAATGTGCG +"@6<:27(F&5)9)"B:%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C> AS:i:-5 XN:i:0 XM:i:3 XO:i:0 XG:i:0 NM:i:3 MD:Z:59G13G21G26 YT:Z:UU
r2 0 gi|9626243|ref|NC_001416.1| 8886 42 275M * 0 0 NTTNTGATGCGGGCTTGTGGAGTTCAG
I just wondered if this means that my SAM file is empty or any thing going wrong with my mapping?
Thanks a lot for any help
1 answer
I wonder what you consider what you consider "pretty different". The only difference I can see is the bowtie2 tutorial example has a short header section, as the reference consists of only one contig - the reference is the complete genome of Enterobacteria phage lambda. Your reference apparently consists of tens or hundreds of short contigs, so it is quite long and head doesn't show any mapped reads. To see the first few mapped reads:
samtools view trialoutput.sorted.sam | head
This won't show header lines, just the mapping section. See also samtools flagstat and samtools stats to see mapping statistics.
Log in to answer this question.
I'm not seeing the glaring problem. Your reference has multiple sequences, theirs has one. Your have repetitive elements; most of your reads map equally well to multiple places, but if that's your reference, then that's your reference. But your mapping hardly failed.
You should scroll further down in your own file. At some point you should start seeing the reads.
headis only showing you top 10 lines.