Hello, I have my own sequence data in the file. Now I want to find the sengemental duplicates from my data.Suppose the data format likes
chr10 89646218 TTTTTTGATTGGGGGATAATTGACCAATAAGGCTTTGATAGCCTCTATTGCCCAGGCCCCTCCTCTTCTTTTA chr10 89646221 TTTGATTGGGGGATAATTGGCCAATAAAGCTTTGATAGCCTCTATTGCCCAGGCCCCTCGTCTTCTTTTATGAGAGAAAGGATGAACAG chr10 89646225 ATTGGGGGATAATTGGCCAATAAAGCTTTGATAGCCTCTATTGCCCAGGCCCCTCCTCTTCTTTTATGAGAGAAAGGATGAACAGTG
The definition of the segmental duplicated is:
sequence identity higher than 90%(or a value you defined) and alignment length 10 kB The data comes from samtools view output. Need advice such as existing software or algorithm idea. Thanks.
1 answer
You neglected to provide information about what constitutes 'sengemental duplicates' for you.
Log in to answer this question.
What do these data represent? What organism and build are you working with?
are you trying to find out if these sequences overlap known SDs?
Not 100% sure what you want here, but your example looks like running a multiple sequence alignment will give you an 'aha'-effect.
While the above comments are all important, in general this is an example of why following even a few of the simple rules for receiving help will be to your benefit. See the link at the top of all BioStar pages. You're now left with people asking you more questions and no answer to assist you in your project.
Sorry about it. I used samtools to extract data to output file out.txt from a bam file. Then I selected some columns which like above data. That means I have a lot of trunks of data. However I found each truck only has 100 characters. I want to find the duplicated which has the maximum length. Maybe it is a multiple sequence alignment problem. However I only can produce 100 character long sequence, how can I find real dups if it is longer than 100? So my question will be two: 1) How to generate a longer sequence from a sam file? 2) After get multiple sequence, how to align them?
Thanks.
the above comment doesn't make it much clearer to me either...
http://seqanswers.com/forums/showthread.php?p=56233 You are cross-posting, but fail to describe your problem sufficiently on seqanswers as well!
Okay. I will rewrite a new thread to make it clear.
nope, don't open a new question, edit your question! add a definition of 'segmental duplicate' that you have in mind, add where your data is coming from.
Just edited it.
your definition makes no sense...