This is a test version of Biostars. For the public version, visit https://www.biostars.org.
genome coordinates for snps

hi all,

i have some rs# and i wanted to know how i could get genomic coordinates for a set of rs# on different assemblies such as hg19, hg18 etc.

thanks.

snp
• 4,021 views • link
updated by Ram Ram • written by win win

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • Genomic coordinates for transcripts
    written by win win
    Hi all, i have transcript IDs such as NM_001250.5, NM_000073.2 and many more. I wanted to know how could I get hg19 genomic coordinates for …
  • HG18 coordinates of rs#
    written by win win
    <p>Hi all, I have a list of rs# and I want HG18 coordinates for each one of them. Is there a tool/ utility that can …
  • Deblock a VCF
    written by win win
    <p>Hi all,</p> <p>I am trying to deblock a gVCF file and it requires an input BED file. While I have the BED files for the …
  • Lift-over on a VCF
    written by win win
    <p>Hi all,</p> <p>I have a VCF file that was generated using HG18 and I want to convert it to VCF but that has HG19 data.</p> …
  • Get dbSNP ids for a gene name
    written by win win
    <p>Hi all,</p> <p>I have a list of genes and I would like a list of rs# for that gene. I can see that one can …
  • Api Or Ui For 1000 Genomes Sample Genotypes
    written by win win
    <p>hi all. i have a list of rs# and other variants that only have chromosome number and variation position (hg19). for each of the variants …
  • Genomics Coordinates From Sequences
    written by win win
    <p>hi all, i have a set of sequences such as </p> <p>GTGAGCACTCATGAACAGTCTGAGTCCGCCCATGGACGCACAGGGCCCAGCACTG(G-C)AGGAAGACAAAGATCCCGCCACGAGCAGGCACGAGACAGCTCCAGGCACTCAGCGT</p> <p>what i want is the genomics coordinates for the location of the SNP. …
  • Single Individual Genotyping After Solid Mate-Pair Sequencing
    written by Vova Naumov Vova Naumov
    <p>Hi! We have reads of a single individual from SOLiD mate-pair, mapped to hg18 (at moment, but we can go to hg19). And I'd like …
  • Bed File Coordinates
    written by win win
    <p>Hi all, In a spreadsheet i have my list of rs# with their chromosomal number and locations. I want to generate a BED file for …
  • Promoter Or Enhancer Regions Bed Format
    written by win win
    <p>Hi all, One can download a BED file of human genome with exonic and intronic chromosomal coordinates. </p> <p>I wanted to know if there is …