This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Split a concatenated alignment in multiple files

I have a concatenated MS alignment of more then 3000 genes in fasta format. I would like to split this alignment in 10-20 files, equally divided if it possible. In my MSA I have 30 seqs, and each seq is made of milions of bp.

>1
ATTGCTGAAACGGCTTTGAAAAGGGCGGAAAATCTTTCTGGTGGT [..]
>2
ATTGCTGAAAC----GGCTTTGAAAAGGGC----GGAAAATCTTTCTGGTGG [..]
>3
ATTGCTGAAAC----GGCTTTGAAAAGGGC----GGAAAATCTTTCTGGTGGT [..]
>4
GATGAGCCGATTGCTTCGCTGGATCCGATGAATGCGCAGGTGGTGATGGACGCTCTTAAG [..]
........

Now I would like to split this file in multiple files having chunks of the MSA. for example file1 from position 1 to 300; file 2 from position 301 to 600; file 3 from 6001 to 900; and so on.

I could not find a way of doing that, any suggestion?

The problem is that most of the tools only split multiple fasta in different files or split single sequences.

PS: I do not have available the original single MSA

alignment fasta

How are they concatenated? Is there any example you could provide?

@mxs, it is just a simple MSA, but instead of having around 1000 bp, each entry (>Ids) has milions of bp

And what is the file format? Multi fasta? Phylip? Stockholm? Something else?

@5heikki, right, it is in fasta.

5 answers

If the seqs have no linebreaks, then e.g.:

awk '{if(/^>/)print $0; else print substr($0,1,4)}' file > output

Would print headers and first 4 characters of each seq into output, while:

awk '{if(/^>/)print $0; else print substr($0,5,4)}' file > output

Would print headers and characters 5-8 to output (substr(string,start index,length)).

That's a good one, but the seqs have line breaks

Well, you can remove those too with awk. I'm not going to write how but google is your friend..

hahah... Great, sorry for my laziness. In this case tr is even easier: tr -d '\n\r'

That tr would delete all linebreaks, including the ones after headers..

I wanted to do the samething. So I wrote this script. This perl script will break the aligned fasta file into smaller chunks from position1 to position2 (1 to 100, 100 to 200,...etc). The default chunk size used in the script is: 500KB.

syntax : <perl splitalignment.pl="">

$filename="seqnew.oneline.fa"; ##Input Aligned fasta file (after alignment)

open FH,"$filename";

while(<FH>)
{
    $header=$_;
    $seq=<FH>;
    @splitSeq=unpack("(A500000)*", $seq); ##Breaks into 500 KB sequence length
    for($i=0;$i<=$#splitSeq;$i++)
        {
        open FH2,">>$filename\_$i";
        print FH2"$header";
        print FH2"$splitSeq[$i]\n";
        }
}

If MSA is in FASTA format.. faSplit is very useful.

http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/?C=D;O=A

$ chmod +x faSplit
$ ./faSplit

prints usage information

this is a realy cool tool, but I am afraid it splits the first seq only and does not take all the sqs in my MSA, did I miss something?

Keep a backup file and/or do with a simple file (containing less number of sequences)..

Try sequence, base, size flags individually. They must do this job.

@venu, you mean use for each alignment single files containing only one sequence; split them; and put them together?

Not yet all..that is a risky task right? Create a MSA with less number of sequences. (I suggest create a protein MSA, in which each sequence length is very less)

When you do ./faSplit it prints some message on how to use. Try each online code on this new MSA file you created. For each output, check it whether it is what you intended.

@venu, thanks I tried that but It is not what I want

fine..we will do this in some other way..you have a MSA of 3000 genes, under each sequence header there are plenty of bp. Now you need 10-20 files that contain your 3000 genes equally distributed. Is this what you exactly want?

Thanks, please see my edit

I have to admit I am a bit confused right now. The line below (regardless of the number of lines in a fasta entry) splits fasta entries in 3 files. each containing equal number of sequences.

perl -lne 'if(/>/){$t++;$x=$t%3; open(O,">>","file.$x.fa");print O $_}else{print O $_} ' fasta.fa
  • fasta.fa - your input
  • 3 - number of files
  • file.0.fa, file.1.fa, file.2.fa - output files

Is this what you are looking for?

UPDATE:

perl -lne 'chomp;if(/>(.*)/){if($s){$i = 0;$z = 3;for(1..$z){open(O,">>","file.$_.fa");print O ">$h"; $f = length($s)/$z; ;print O substr($s, int($i), int($f+1)); $i=int($i+$f+1);}};$h = $1;$i = 0; $f = 0;$s = ""}else{$s .=$_} ' fasta.fa

3 is the number of files. If modified it has to be changed to something else $z = 5 for 5 output files.

Quick explanation:

The one-liner above takes your input fasta.fa file (which has many fasta records and each can be be separated in multiple lines).

>1
atggatgatag
gcgctgctcgtc
gctagctgat
>2
gcgctgctcgtc
gctagctgat

and divides this initial file into $z number of files splitting each fasta record accordingly. This means if fasta seq 1 has 33 nt's and number of files is 4 then 3 files will contain 9 nt's and the last one 6. The same dividing strategy holds for >2 and >3 ...

thanks, but it seems that it separates the seqs and does not split the alignment. Lets say that in my file I have: >seq1: >seq2; >seq3. You script will divide this in 3 files containing 1 seq each. Instead I want multiple files having all 3 seqs but with a shorter length of the original

Aha. Is there any limitation on the length? Can they all be of equal size? (Let's say 300)

I do not know which size suits me the nest, because I have to feed this seqs to another program. Duno what it likes.

Hi, your code seem to be working in my case, but its deleting the last individual from my original alignment. It has a total of 60 individuals and the resulting splitted fasta files each have 59. Do you know how to solve this?

You can do this using pyfaidx:

pip install --user pyfaidx
faidx -i file.fa | cut -f1 | xargs -n 300 | while read region; do faidx file.fa $region > file.$RANDOM.fa; done

Log in to answer this question.